Incidental Mutation 'R7487:1110002E22Rik'
ID 580231
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene Name RIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock # R7487 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 138065052-138081506 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 138066868 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 606 (D606V)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably damaging
Transcript: ENSMUST00000163080
AA Change: D606V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: D606V

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Meta Mutation Damage Score 0.1560 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (89/89)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik T A 4: 39,450,929 V45E probably damaging Het
2510009E07Rik C T 16: 21,653,729 V74M probably damaging Het
Abca2 C T 2: 25,437,903 T739M probably benign Het
Abra T C 15: 41,869,553 E39G probably damaging Het
Adam34 A T 8: 43,651,154 C485S probably damaging Het
Add2 G T 6: 86,093,450 V175F possibly damaging Het
Alk T A 17: 71,949,898 K655N probably benign Het
Ap3m1 A G 14: 21,038,039 V317A probably benign Het
Astn1 A G 1: 158,610,782 probably null Het
Atm A T 9: 53,524,354 Y219N probably benign Het
Cep128 C T 12: 90,999,630 A1068T probably benign Het
Cnksr3 T C 10: 7,135,097 Q250R probably benign Het
Cst7 A G 2: 150,577,704 T97A probably benign Het
Ctps G A 4: 120,558,800 L209F probably damaging Het
Cyp2d10 A T 15: 82,404,592 F230I probably benign Het
Daam2 T C 17: 49,486,482 N336D probably benign Het
Dchs2 T C 3: 83,356,306 S3294P probably damaging Het
Dhx36 G T 3: 62,484,202 N574K possibly damaging Het
Dock10 G T 1: 80,585,048 Q533K probably benign Het
Dync2h1 A G 9: 7,132,041 S1589P probably benign Het
Enpp3 T A 10: 24,805,923 Y295F probably benign Het
Esrrg T A 1: 188,146,423 Y234N probably benign Het
Fadd A C 7: 144,580,725 V141G probably damaging Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fam170b T A 14: 32,835,819 C204S probably damaging Het
Fam186a T A 15: 99,942,136 I2076F possibly damaging Het
Fdxacb1 G A 9: 50,770,219 V147I possibly damaging Het
Fopnl T C 16: 14,311,104 D85G probably benign Het
Frem2 C A 3: 53,654,549 V846F probably benign Het
Fry G A 5: 150,414,574 S1449N possibly damaging Het
Gucy1b2 A G 14: 62,448,223 F98L probably damaging Het
Hps1 T C 19: 42,756,261 Y658C probably damaging Het
Igkv3-9 T A 6: 70,588,522 L35Q probably damaging Het
Irx2 A G 13: 72,630,620 Y101C probably damaging Het
Kcnj11 G T 7: 46,098,841 R353S probably benign Het
Kyat3 C T 3: 142,726,194 Q228* probably null Het
Lama3 T A 18: 12,419,237 D415E probably benign Het
Lcn3 G A 2: 25,766,162 probably null Het
Lin7b T C 7: 45,369,940 E68G possibly damaging Het
Lmbr1 T A 5: 29,254,264 K379M probably benign Het
Lrig1 A G 6: 94,606,118 S1006P probably benign Het
Lrrc37a T G 11: 103,498,219 T2127P unknown Het
Map4 A G 9: 110,027,715 D151G probably damaging Het
March1 A T 8: 66,456,074 T149S probably benign Het
Msh4 A T 3: 153,863,510 F809I probably damaging Het
Muc16 G A 9: 18,584,799 P6699S possibly damaging Het
Mxi1 A T 19: 53,371,657 D270V probably damaging Het
Myh6 A T 14: 54,953,496 C907* probably null Het
Myo18b T C 5: 112,834,433 R1145G possibly damaging Het
Nkx2-6 A C 14: 69,171,940 N47H probably benign Het
Nol7 G A 13: 43,398,600 A66T probably damaging Het
Ntrk3 T C 7: 78,250,713 N626S probably damaging Het
Nwd1 A G 8: 72,666,638 Y77C unknown Het
Olfr1057 A T 2: 86,375,131 Y94N probably damaging Het
Olfr109 G T 17: 37,466,566 R120L probably damaging Het
Olfr1413 G A 1: 92,573,795 G208D possibly damaging Het
Olfr358 A C 2: 37,004,774 V280G probably damaging Het
Olfr892-ps1 A G 9: 38,190,060 S112G probably damaging Het
Otop3 A G 11: 115,345,000 D486G probably benign Het
Pak1ip1 A G 13: 41,009,255 K178R probably benign Het
Pcsk1 G A 13: 75,110,883 G259S probably benign Het
Pde6a A G 18: 61,249,960 D338G probably damaging Het
Pias4 A T 10: 81,163,972 D82E probably benign Het
Plekha5 C A 6: 140,570,333 Q771K probably benign Het
Plekhh3 C A 11: 101,165,579 A397S possibly damaging Het
Prg4 G T 1: 150,455,905 T339N unknown Het
Prss22 A T 17: 23,997,997 I3N probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rspo2 T C 15: 43,078,114 T138A probably benign Het
Rtcb C T 10: 85,953,469 G70S probably benign Het
Selenov A T 7: 28,290,378 S234T probably damaging Het
Shtn1 T C 19: 59,003,860 T429A probably damaging Het
Slc4a3 G T 1: 75,553,377 R622L probably benign Het
Smc2 T C 4: 52,478,448 I1015T probably damaging Het
Spata9 G T 13: 75,967,840 V3F possibly damaging Het
Tlr4 T C 4: 66,924,422 I105T probably benign Het
Trav6d-4 A T 14: 52,753,639 Y47F possibly damaging Het
Ttn A T 2: 76,827,033 I12450N unknown Het
Umad1 G T 6: 8,270,560 A21S probably damaging Het
Unc5a G A 13: 54,996,549 R229H probably benign Het
Vmn1r216 A T 13: 23,099,860 M238L probably damaging Het
Vps16 T A 2: 130,439,057 C255* probably null Het
Wdr89 A G 12: 75,632,614 F289L probably benign Het
Zfp180 A T 7: 24,106,100 H648L probably damaging Het
Zfp735 A G 11: 73,690,328 K64E possibly damaging Het
Zfp990 G A 4: 145,537,587 C385Y probably damaging Het
Zswim3 G T 2: 164,820,215 S205I probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 138068395 missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 138067782 missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 138066450 missense probably benign
R8434:1110002E22Rik UTSW 3 138067260 missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 138068825 missense probably damaging 0.99
R8754:1110002E22Rik UTSW 3 138066037 missense probably benign
R8808:1110002E22Rik UTSW 3 138070113 missense probably benign 0.01
R8891:1110002E22Rik UTSW 3 138066759 nonsense probably null
R9026:1110002E22Rik UTSW 3 138065148 missense possibly damaging 0.53
R9177:1110002E22Rik UTSW 3 138069916 missense probably damaging 1.00
R9250:1110002E22Rik UTSW 3 138066628 missense probably damaging 1.00
R9291:1110002E22Rik UTSW 3 138066703 missense probably benign 0.02
R9293:1110002E22Rik UTSW 3 138066078 missense possibly damaging 0.93
R9307:1110002E22Rik UTSW 3 138065422 missense probably benign 0.04
R9439:1110002E22Rik UTSW 3 138066287 missense probably benign 0.00
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGCATGAAGGCGACATG -3'
(R):5'- TTTGCTGACCACAAACTCCAAG -3'

Sequencing Primer
(F):5'- GAGTCTCTTCAGCTGCTGAACAC -3'
(R):5'- AAGGCCTTGGTCTGCGACTTC -3'
Posted On 2019-10-07