Incidental Mutation 'R7487:Tlr4'
ID580236
Institutional Source Beutler Lab
Gene Symbol Tlr4
Ensembl Gene ENSMUSG00000039005
Gene Nametoll-like receptor 4
SynonymsRasl2-8, Lps, lipopolysaccharide response
MMRRC Submission
Accession Numbers

MGI: 96824

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7487 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location66827584-66930284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66924422 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 105 (I105T)
Ref Sequence ENSEMBL: ENSMUSP00000102988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107365]
Predicted Effect probably benign
Transcript: ENSMUST00000107365
AA Change: I105T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005
AA Change: I105T

DomainStartEndE-ValueType
PDB:3VQ2|B 22 86 2e-38 PDB
SCOP:d1m0za_ 27 86 4e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,868 D606V probably damaging Het
1700009N14Rik T A 4: 39,450,929 V45E probably damaging Het
2510009E07Rik C T 16: 21,653,729 V74M probably damaging Het
Abca2 C T 2: 25,437,903 T739M probably benign Het
Abra T C 15: 41,869,553 E39G probably damaging Het
Adam34 A T 8: 43,651,154 C485S probably damaging Het
Add2 G T 6: 86,093,450 V175F possibly damaging Het
Alk T A 17: 71,949,898 K655N probably benign Het
Ap3m1 A G 14: 21,038,039 V317A probably benign Het
Astn1 A G 1: 158,610,782 probably null Het
Atm A T 9: 53,524,354 Y219N probably benign Het
Cep128 C T 12: 90,999,630 A1068T probably benign Het
Cnksr3 T C 10: 7,135,097 Q250R probably benign Het
Cst7 A G 2: 150,577,704 T97A probably benign Het
Ctps G A 4: 120,558,800 L209F probably damaging Het
Cyp2d10 A T 15: 82,404,592 F230I probably benign Het
Daam2 T C 17: 49,486,482 N336D probably benign Het
Dchs2 T C 3: 83,356,306 S3294P probably damaging Het
Dhx36 G T 3: 62,484,202 N574K possibly damaging Het
Dock10 G T 1: 80,585,048 Q533K probably benign Het
Dync2h1 A G 9: 7,132,041 S1589P probably benign Het
Enpp3 T A 10: 24,805,923 Y295F probably benign Het
Esrrg T A 1: 188,146,423 Y234N probably benign Het
Fadd A C 7: 144,580,725 V141G probably damaging Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fam170b T A 14: 32,835,819 C204S probably damaging Het
Fam186a T A 15: 99,942,136 I2076F possibly damaging Het
Fdxacb1 G A 9: 50,770,219 V147I possibly damaging Het
Fopnl T C 16: 14,311,104 D85G probably benign Het
Frem2 C A 3: 53,654,549 V846F probably benign Het
Fry G A 5: 150,414,574 S1449N possibly damaging Het
Gucy1b2 A G 14: 62,448,223 F98L probably damaging Het
Hps1 T C 19: 42,756,261 Y658C probably damaging Het
Igkv3-9 T A 6: 70,588,522 L35Q probably damaging Het
Irx2 A G 13: 72,630,620 Y101C probably damaging Het
Kcnj11 G T 7: 46,098,841 R353S probably benign Het
Kyat3 C T 3: 142,726,194 Q228* probably null Het
Lama3 T A 18: 12,419,237 D415E probably benign Het
Lcn3 G A 2: 25,766,162 probably null Het
Lin7b T C 7: 45,369,940 E68G possibly damaging Het
Lmbr1 T A 5: 29,254,264 K379M probably benign Het
Lrig1 A G 6: 94,606,118 S1006P probably benign Het
Lrrc37a T G 11: 103,498,219 T2127P unknown Het
Map4 A G 9: 110,027,715 D151G probably damaging Het
March1 A T 8: 66,456,074 T149S probably benign Het
Msh4 A T 3: 153,863,510 F809I probably damaging Het
Muc16 G A 9: 18,584,799 P6699S possibly damaging Het
Mxi1 A T 19: 53,371,657 D270V probably damaging Het
Myh6 A T 14: 54,953,496 C907* probably null Het
Myo18b T C 5: 112,834,433 R1145G possibly damaging Het
Nkx2-6 A C 14: 69,171,940 N47H probably benign Het
Nol7 G A 13: 43,398,600 A66T probably damaging Het
Ntrk3 T C 7: 78,250,713 N626S probably damaging Het
Nwd1 A G 8: 72,666,638 Y77C unknown Het
Olfr1057 A T 2: 86,375,131 Y94N probably damaging Het
Olfr109 G T 17: 37,466,566 R120L probably damaging Het
Olfr1413 G A 1: 92,573,795 G208D possibly damaging Het
Olfr358 A C 2: 37,004,774 V280G probably damaging Het
Olfr892-ps1 A G 9: 38,190,060 S112G probably damaging Het
Otop3 A G 11: 115,345,000 D486G probably benign Het
Pak1ip1 A G 13: 41,009,255 K178R probably benign Het
Pcsk1 G A 13: 75,110,883 G259S probably benign Het
Pde6a A G 18: 61,249,960 D338G probably damaging Het
Pias4 A T 10: 81,163,972 D82E probably benign Het
Plekha5 C A 6: 140,570,333 Q771K probably benign Het
Plekhh3 C A 11: 101,165,579 A397S possibly damaging Het
Prg4 G T 1: 150,455,905 T339N unknown Het
Prss22 A T 17: 23,997,997 I3N probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rspo2 T C 15: 43,078,114 T138A probably benign Het
Rtcb C T 10: 85,953,469 G70S probably benign Het
Selenov A T 7: 28,290,378 S234T probably damaging Het
Shtn1 T C 19: 59,003,860 T429A probably damaging Het
Slc4a3 G T 1: 75,553,377 R622L probably benign Het
Smc2 T C 4: 52,478,448 I1015T probably damaging Het
Spata9 G T 13: 75,967,840 V3F possibly damaging Het
Trav6d-4 A T 14: 52,753,639 Y47F possibly damaging Het
Ttn A T 2: 76,827,033 I12450N unknown Het
Umad1 G T 6: 8,270,560 A21S probably damaging Het
Unc5a G A 13: 54,996,549 R229H probably benign Het
Vmn1r216 A T 13: 23,099,860 M238L probably damaging Het
Vps16 T A 2: 130,439,057 C255* probably null Het
Wdr89 A G 12: 75,632,614 F289L probably benign Het
Zfp180 A T 7: 24,106,100 H648L probably damaging Het
Zfp735 A G 11: 73,690,328 K64E possibly damaging Het
Zfp990 G A 4: 145,537,587 C385Y probably damaging Het
Zswim3 G T 2: 164,820,215 S205I probably damaging Het
Other mutations in Tlr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66840425 missense probably benign 0.01
IGL01343:Tlr4 APN 4 66833887 splice site probably benign
IGL01669:Tlr4 APN 4 66841267 missense possibly damaging 0.48
IGL01875:Tlr4 APN 4 66839489 missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66840965 missense probably damaging 0.99
IGL02244:Tlr4 APN 4 66834061 critical splice donor site probably null
IGL02793:Tlr4 APN 4 66839444 missense probably damaging 1.00
IGL03269:Tlr4 APN 4 66840796 missense probably damaging 1.00
IGL03288:Tlr4 APN 4 66839753 missense probably damaging 0.99
bugsy UTSW 4 66839254 nonsense probably null
Cruyff UTSW 4 66840326 missense probably damaging 1.00
don_knotts UTSW 4 66841172 missense probably damaging 1.00
Guardiola UTSW 4 66839303 missense probably damaging 1.00
Lops UTSW 4 66833880 splice site probably null
lps3 UTSW 4 66841097 missense probably damaging 1.00
Lps4 UTSW 4 66841142 missense probably damaging 1.00
milquetoast UTSW 4 66839444 missense probably damaging 1.00
salvador UTSW 4 66840206 missense probably damaging 0.99
R0449:Tlr4 UTSW 4 66839620 missense probably damaging 0.99
R0481:Tlr4 UTSW 4 66827916 missense probably benign 0.05
R0576:Tlr4 UTSW 4 66839495 missense probably benign 0.00
R0827:Tlr4 UTSW 4 66833880 splice site probably null
R1488:Tlr4 UTSW 4 66839549 missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66839374 missense possibly damaging 0.56
R1522:Tlr4 UTSW 4 66839696 missense possibly damaging 0.80
R1616:Tlr4 UTSW 4 66839480 missense probably damaging 1.00
R1681:Tlr4 UTSW 4 66841105 missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66841076 missense probably benign 0.19
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1929:Tlr4 UTSW 4 66839444 missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66841035 missense probably benign 0.40
R1998:Tlr4 UTSW 4 66840470 missense probably damaging 1.00
R2186:Tlr4 UTSW 4 66839983 missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66840101 missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66839254 nonsense probably null
R3420:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3422:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3818:Tlr4 UTSW 4 66841316 missense probably benign 0.00
R4212:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4417:Tlr4 UTSW 4 66839303 missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66839240 missense probably benign 0.44
R4735:Tlr4 UTSW 4 66841198 missense probably damaging 1.00
R5191:Tlr4 UTSW 4 66841379 missense probably damaging 0.96
R5613:Tlr4 UTSW 4 66840885 missense possibly damaging 0.94
R5705:Tlr4 UTSW 4 66833980 missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66840415 missense probably benign
R6021:Tlr4 UTSW 4 66840866 missense probably damaging 1.00
R6159:Tlr4 UTSW 4 66839833 missense possibly damaging 0.92
R6227:Tlr4 UTSW 4 66840595 missense probably benign
R7139:Tlr4 UTSW 4 66840283 missense probably benign 0.06
R7199:Tlr4 UTSW 4 66841193 missense probably damaging 0.99
R7220:Tlr4 UTSW 4 66839951 missense probably benign
R7337:Tlr4 UTSW 4 66839954 missense possibly damaging 0.86
R7638:Tlr4 UTSW 4 66840206 missense probably damaging 0.99
R7773:Tlr4 UTSW 4 66839599 missense probably damaging 1.00
R7814:Tlr4 UTSW 4 66841079 missense probably damaging 1.00
R7897:Tlr4 UTSW 4 66839821 missense probably benign 0.07
R8044:Tlr4 UTSW 4 66827847 missense probably benign 0.01
R8062:Tlr4 UTSW 4 66839850 missense probably benign 0.00
R8080:Tlr4 UTSW 4 66839476 missense probably damaging 1.00
X0064:Tlr4 UTSW 4 66840140 missense probably damaging 0.99
Z1088:Tlr4 UTSW 4 66929082 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGGTTTGCTCCTAGATGAG -3'
(R):5'- AATGGACATGGCTTCAGCGAC -3'

Sequencing Primer
(F):5'- GTAAAATGCATTTTGGGAAGGC -3'
(R):5'- GGCTTCAGCGACCTTTAATTTAATAC -3'
Posted On2019-10-07