Incidental Mutation 'R7487:Muc16'
ID 580256
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Name mucin 16
Synonyms 1110008I14Rik, LOC385009
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock # R7487 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 18495455-18674530 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 18584799 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 6699 (P6699S)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
AlphaFold no structure available at present
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000208663
AA Change: P6699S

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (89/89)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,868 D606V probably damaging Het
1700009N14Rik T A 4: 39,450,929 V45E probably damaging Het
2510009E07Rik C T 16: 21,653,729 V74M probably damaging Het
Abca2 C T 2: 25,437,903 T739M probably benign Het
Abra T C 15: 41,869,553 E39G probably damaging Het
Adam34 A T 8: 43,651,154 C485S probably damaging Het
Add2 G T 6: 86,093,450 V175F possibly damaging Het
Alk T A 17: 71,949,898 K655N probably benign Het
Ap3m1 A G 14: 21,038,039 V317A probably benign Het
Astn1 A G 1: 158,610,782 probably null Het
Atm A T 9: 53,524,354 Y219N probably benign Het
Cep128 C T 12: 90,999,630 A1068T probably benign Het
Cnksr3 T C 10: 7,135,097 Q250R probably benign Het
Cst7 A G 2: 150,577,704 T97A probably benign Het
Ctps G A 4: 120,558,800 L209F probably damaging Het
Cyp2d10 A T 15: 82,404,592 F230I probably benign Het
Daam2 T C 17: 49,486,482 N336D probably benign Het
Dchs2 T C 3: 83,356,306 S3294P probably damaging Het
Dhx36 G T 3: 62,484,202 N574K possibly damaging Het
Dock10 G T 1: 80,585,048 Q533K probably benign Het
Dync2h1 A G 9: 7,132,041 S1589P probably benign Het
Enpp3 T A 10: 24,805,923 Y295F probably benign Het
Esrrg T A 1: 188,146,423 Y234N probably benign Het
Fadd A C 7: 144,580,725 V141G probably damaging Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fam170b T A 14: 32,835,819 C204S probably damaging Het
Fam186a T A 15: 99,942,136 I2076F possibly damaging Het
Fdxacb1 G A 9: 50,770,219 V147I possibly damaging Het
Fopnl T C 16: 14,311,104 D85G probably benign Het
Frem2 C A 3: 53,654,549 V846F probably benign Het
Fry G A 5: 150,414,574 S1449N possibly damaging Het
Gucy1b2 A G 14: 62,448,223 F98L probably damaging Het
Hps1 T C 19: 42,756,261 Y658C probably damaging Het
Igkv3-9 T A 6: 70,588,522 L35Q probably damaging Het
Irx2 A G 13: 72,630,620 Y101C probably damaging Het
Kcnj11 G T 7: 46,098,841 R353S probably benign Het
Kyat3 C T 3: 142,726,194 Q228* probably null Het
Lama3 T A 18: 12,419,237 D415E probably benign Het
Lcn3 G A 2: 25,766,162 probably null Het
Lin7b T C 7: 45,369,940 E68G possibly damaging Het
Lmbr1 T A 5: 29,254,264 K379M probably benign Het
Lrig1 A G 6: 94,606,118 S1006P probably benign Het
Lrrc37a T G 11: 103,498,219 T2127P unknown Het
Map4 A G 9: 110,027,715 D151G probably damaging Het
March1 A T 8: 66,456,074 T149S probably benign Het
Msh4 A T 3: 153,863,510 F809I probably damaging Het
Mxi1 A T 19: 53,371,657 D270V probably damaging Het
Myh6 A T 14: 54,953,496 C907* probably null Het
Myo18b T C 5: 112,834,433 R1145G possibly damaging Het
Nkx2-6 A C 14: 69,171,940 N47H probably benign Het
Nol7 G A 13: 43,398,600 A66T probably damaging Het
Ntrk3 T C 7: 78,250,713 N626S probably damaging Het
Nwd1 A G 8: 72,666,638 Y77C unknown Het
Olfr1057 A T 2: 86,375,131 Y94N probably damaging Het
Olfr109 G T 17: 37,466,566 R120L probably damaging Het
Olfr1413 G A 1: 92,573,795 G208D possibly damaging Het
Olfr358 A C 2: 37,004,774 V280G probably damaging Het
Olfr892-ps1 A G 9: 38,190,060 S112G probably damaging Het
Otop3 A G 11: 115,345,000 D486G probably benign Het
Pak1ip1 A G 13: 41,009,255 K178R probably benign Het
Pcsk1 G A 13: 75,110,883 G259S probably benign Het
Pde6a A G 18: 61,249,960 D338G probably damaging Het
Pias4 A T 10: 81,163,972 D82E probably benign Het
Plekha5 C A 6: 140,570,333 Q771K probably benign Het
Plekhh3 C A 11: 101,165,579 A397S possibly damaging Het
Prg4 G T 1: 150,455,905 T339N unknown Het
Prss22 A T 17: 23,997,997 I3N probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rspo2 T C 15: 43,078,114 T138A probably benign Het
Rtcb C T 10: 85,953,469 G70S probably benign Het
Selenov A T 7: 28,290,378 S234T probably damaging Het
Shtn1 T C 19: 59,003,860 T429A probably damaging Het
Slc4a3 G T 1: 75,553,377 R622L probably benign Het
Smc2 T C 4: 52,478,448 I1015T probably damaging Het
Spata9 G T 13: 75,967,840 V3F possibly damaging Het
Tlr4 T C 4: 66,924,422 I105T probably benign Het
Trav6d-4 A T 14: 52,753,639 Y47F possibly damaging Het
Ttn A T 2: 76,827,033 I12450N unknown Het
Umad1 G T 6: 8,270,560 A21S probably damaging Het
Unc5a G A 13: 54,996,549 R229H probably benign Het
Vmn1r216 A T 13: 23,099,860 M238L probably damaging Het
Vps16 T A 2: 130,439,057 C255* probably null Het
Wdr89 A G 12: 75,632,614 F289L probably benign Het
Zfp180 A T 7: 24,106,100 H648L probably damaging Het
Zfp735 A G 11: 73,690,328 K64E possibly damaging Het
Zfp990 G A 4: 145,537,587 C385Y probably damaging Het
Zswim3 G T 2: 164,820,215 S205I probably damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R7038_muc16_859 UTSW 9 18620468 missense probably damaging 0.99
Runneymeade UTSW 9 18579317 critical splice donor site probably null
slimey UTSW 9 18590698 missense probably damaging 1.00
viscous UTSW 9 18644732 missense unknown
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 splice site probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 splice site probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
R7743:Muc16 UTSW 9 18657477 missense unknown
R7744:Muc16 UTSW 9 18585096 critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18580574 missense probably damaging 1.00
R7769:Muc16 UTSW 9 18660507 missense unknown
R7805:Muc16 UTSW 9 18638493 missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18595223 missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18640773 missense probably benign 0.01
R7849:Muc16 UTSW 9 18640505 missense probably benign 0.01
R7884:Muc16 UTSW 9 18642694 missense unknown
R7885:Muc16 UTSW 9 18639464 missense probably benign 0.10
R7886:Muc16 UTSW 9 18585982 missense probably benign 0.03
R7899:Muc16 UTSW 9 18640697 missense probably benign 0.01
R7904:Muc16 UTSW 9 18655650 missense unknown
R7921:Muc16 UTSW 9 18659318 missense unknown
R7922:Muc16 UTSW 9 18584825 missense probably benign 0.16
R7948:Muc16 UTSW 9 18642490 missense unknown
R7957:Muc16 UTSW 9 18643471 missense unknown
R7972:Muc16 UTSW 9 18645764 nonsense probably null
R7992:Muc16 UTSW 9 18656429 missense unknown
R7998:Muc16 UTSW 9 18639892 missense probably benign 0.04
R8014:Muc16 UTSW 9 18654875 missense unknown
R8033:Muc16 UTSW 9 18636606 missense probably benign 0.26
R8052:Muc16 UTSW 9 18659051 missense unknown
R8058:Muc16 UTSW 9 18660002 nonsense probably null
R8088:Muc16 UTSW 9 18519300 nonsense probably null
R8095:Muc16 UTSW 9 18584830 nonsense probably null
R8111:Muc16 UTSW 9 18592629 missense possibly damaging 0.55
R8116:Muc16 UTSW 9 18658737 missense unknown
R8117:Muc16 UTSW 9 18508910 nonsense probably null
R8137:Muc16 UTSW 9 18645676 missense unknown
R8196:Muc16 UTSW 9 18645334 missense unknown
R8218:Muc16 UTSW 9 18637019 missense possibly damaging 0.48
R8285:Muc16 UTSW 9 18642977 missense unknown
R8313:Muc16 UTSW 9 18525147 missense possibly damaging 0.85
R8317:Muc16 UTSW 9 18658043 missense unknown
R8342:Muc16 UTSW 9 18658685 missense unknown
R8351:Muc16 UTSW 9 18659885 missense unknown
R8356:Muc16 UTSW 9 18658778 missense unknown
R8360:Muc16 UTSW 9 18525258 missense probably benign 0.01
R8418:Muc16 UTSW 9 18519630 missense possibly damaging 0.94
R8420:Muc16 UTSW 9 18537511 missense probably damaging 0.99
R8437:Muc16 UTSW 9 18657924 missense unknown
R8463:Muc16 UTSW 9 18659139 missense unknown
R8466:Muc16 UTSW 9 18643148 missense unknown
R8512:Muc16 UTSW 9 18638192 missense probably benign 0.01
R8518:Muc16 UTSW 9 18519631 missense probably benign 0.12
R8556:Muc16 UTSW 9 18640937 missense probably benign 0.01
R8679:Muc16 UTSW 9 18646448 missense unknown
R8680:Muc16 UTSW 9 18644719 missense unknown
R8720:Muc16 UTSW 9 18641600 missense probably benign 0.01
R8729:Muc16 UTSW 9 18660050 missense unknown
R8736:Muc16 UTSW 9 18550843 nonsense probably null
R8739:Muc16 UTSW 9 18637298 missense probably benign 0.10
R8807:Muc16 UTSW 9 18656057 missense unknown
R8830:Muc16 UTSW 9 18646069 missense unknown
R8871:Muc16 UTSW 9 18656048 missense unknown
R8884:Muc16 UTSW 9 18644200 missense unknown
R8923:Muc16 UTSW 9 18638676 missense probably benign 0.01
R8948:Muc16 UTSW 9 18647233 missense unknown
R8949:Muc16 UTSW 9 18520925 critical splice donor site probably null
R8987:Muc16 UTSW 9 18551685 nonsense probably null
R8997:Muc16 UTSW 9 18607467 intron probably benign
R9013:Muc16 UTSW 9 18512773 missense possibly damaging 0.94
R9020:Muc16 UTSW 9 18638719 small insertion probably benign
R9036:Muc16 UTSW 9 18644679 missense unknown
R9040:Muc16 UTSW 9 18644786 nonsense probably null
R9065:Muc16 UTSW 9 18643009 missense unknown
R9089:Muc16 UTSW 9 18644550 missense unknown
R9098:Muc16 UTSW 9 18643679 missense unknown
R9100:Muc16 UTSW 9 18645670 missense unknown
R9128:Muc16 UTSW 9 18647582 missense unknown
R9169:Muc16 UTSW 9 18656528 missense unknown
R9180:Muc16 UTSW 9 18642742 missense unknown
R9191:Muc16 UTSW 9 18644810 missense unknown
R9203:Muc16 UTSW 9 18551688 missense unknown
R9208:Muc16 UTSW 9 18508537 missense probably damaging 0.99
R9232:Muc16 UTSW 9 18656040 missense unknown
R9240:Muc16 UTSW 9 18538013 missense unknown
R9254:Muc16 UTSW 9 18646171 missense unknown
R9330:Muc16 UTSW 9 18641036 missense probably benign 0.04
R9347:Muc16 UTSW 9 18660215 missense unknown
R9358:Muc16 UTSW 9 18642224 missense probably benign 0.01
R9359:Muc16 UTSW 9 18537764 critical splice donor site probably null
R9379:Muc16 UTSW 9 18646171 missense unknown
R9403:Muc16 UTSW 9 18537764 critical splice donor site probably null
R9422:Muc16 UTSW 9 18641806 missense probably benign 0.01
R9433:Muc16 UTSW 9 18572641 missense probably benign 0.09
R9438:Muc16 UTSW 9 18647732 missense unknown
R9442:Muc16 UTSW 9 18655328 missense unknown
R9453:Muc16 UTSW 9 18660765 missense unknown
R9467:Muc16 UTSW 9 18597035 missense probably benign 0.03
Z1177:Muc16 UTSW 9 18537571 missense probably benign 0.26
Z1177:Muc16 UTSW 9 18657861 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGTAGAAGAAATGTTTGGCATTC -3'
(R):5'- TGAACATCACGCAGCTAGGG -3'

Sequencing Primer
(F):5'- TGGCATTCCTTCAGAAACAGTGG -3'
(R):5'- TAGGGCCCTACATCGTGGAC -3'
Posted On 2019-10-07