Incidental Mutation 'R7487:Myh6'
ID580282
Institutional Source Beutler Lab
Gene Symbol Myh6
Ensembl Gene ENSMUSG00000040752
Gene Namemyosin, heavy polypeptide 6, cardiac muscle, alpha
Synonymsalpha myosin, A830009F23Rik, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, Myhc-a, alpha-MHC
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7487 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location54941921-54966927 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 54953496 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 907 (C907*)
Ref Sequence ENSEMBL: ENSMUSP00000080538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081857] [ENSMUST00000226297]
Predicted Effect probably null
Transcript: ENSMUST00000081857
AA Change: C907*
SMART Domains Protein: ENSMUSP00000080538
Gene: ENSMUSG00000040752
AA Change: C907*

DomainStartEndE-ValueType
Pfam:Myosin_N 34 73 1.9e-15 PFAM
MYSc 79 781 N/A SMART
IQ 782 804 1.15e-1 SMART
IQ 808 830 3.32e2 SMART
Pfam:Myosin_tail_1 845 1926 2.1e-162 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226297
AA Change: C907*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cardiac muscle myosin is a hexamer consisting of two heavy chain subunits, two light chain subunits, and two regulatory subunits. This gene encodes the alpha heavy chain subunit of cardiac myosin. The gene is located approximately 4kb downstream of the gene encoding the beta heavy chain subunit of cardiac myosin. Mutations in this gene cause familial hypertrophic cardiomyopathy and atrial septal defect 3. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality associated with heart defects while heterozygotes show cardiac myofibrillar disarray, cardiac dysfunction and fibrosis. Mice heterozygous for different knock-in alleles may develop hypertrophic or dilated forms of cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,868 D606V probably damaging Het
1700009N14Rik T A 4: 39,450,929 V45E probably damaging Het
2510009E07Rik C T 16: 21,653,729 V74M probably damaging Het
Abca2 C T 2: 25,437,903 T739M probably benign Het
Abra T C 15: 41,869,553 E39G probably damaging Het
Adam34 A T 8: 43,651,154 C485S probably damaging Het
Add2 G T 6: 86,093,450 V175F possibly damaging Het
Alk T A 17: 71,949,898 K655N probably benign Het
Ap3m1 A G 14: 21,038,039 V317A probably benign Het
Atm A T 9: 53,524,354 Y219N probably benign Het
Cep128 C T 12: 90,999,630 A1068T probably benign Het
Cnksr3 T C 10: 7,135,097 Q250R probably benign Het
Cst7 A G 2: 150,577,704 T97A probably benign Het
Ctps G A 4: 120,558,800 L209F probably damaging Het
Cyp2d10 A T 15: 82,404,592 F230I probably benign Het
Daam2 T C 17: 49,486,482 N336D probably benign Het
Dchs2 T C 3: 83,356,306 S3294P probably damaging Het
Dhx36 G T 3: 62,484,202 N574K possibly damaging Het
Dock10 G T 1: 80,585,048 Q533K probably benign Het
Dync2h1 A G 9: 7,132,041 S1589P probably benign Het
Enpp3 T A 10: 24,805,923 Y295F probably benign Het
Esrrg T A 1: 188,146,423 Y234N probably benign Het
Fadd A C 7: 144,580,725 V141G probably damaging Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fam170b T A 14: 32,835,819 C204S probably damaging Het
Fam186a T A 15: 99,942,136 I2076F possibly damaging Het
Fdxacb1 G A 9: 50,770,219 V147I possibly damaging Het
Fopnl T C 16: 14,311,104 D85G probably benign Het
Frem2 C A 3: 53,654,549 V846F probably benign Het
Fry G A 5: 150,414,574 S1449N possibly damaging Het
Gucy1b2 A G 14: 62,448,223 F98L probably damaging Het
Hps1 T C 19: 42,756,261 Y658C probably damaging Het
Igkv3-9 T A 6: 70,588,522 L35Q probably damaging Het
Irx2 A G 13: 72,630,620 Y101C probably damaging Het
Kcnj11 G T 7: 46,098,841 R353S probably benign Het
Kyat3 C T 3: 142,726,194 Q228* probably null Het
Lama3 T A 18: 12,419,237 D415E probably benign Het
Lcn3 G A 2: 25,766,162 probably null Het
Lin7b T C 7: 45,369,940 E68G possibly damaging Het
Lmbr1 T A 5: 29,254,264 K379M probably benign Het
Lrig1 A G 6: 94,606,118 S1006P probably benign Het
Lrrc37a T G 11: 103,498,219 T2127P unknown Het
Map4 A G 9: 110,027,715 D151G probably damaging Het
March1 A T 8: 66,456,074 T149S probably benign Het
Msh4 A T 3: 153,863,510 F809I probably damaging Het
Muc16 G A 9: 18,584,799 P6699S possibly damaging Het
Mxi1 A T 19: 53,371,657 D270V probably damaging Het
Myo18b T C 5: 112,834,433 R1145G possibly damaging Het
Nkx2-6 A C 14: 69,171,940 N47H probably benign Het
Nol7 G A 13: 43,398,600 A66T probably damaging Het
Ntrk3 T C 7: 78,250,713 N626S probably damaging Het
Olfr1057 A T 2: 86,375,131 Y94N probably damaging Het
Olfr109 G T 17: 37,466,566 R120L probably damaging Het
Olfr1413 G A 1: 92,573,795 G208D possibly damaging Het
Olfr358 A C 2: 37,004,774 V280G probably damaging Het
Olfr892-ps1 A G 9: 38,190,060 S112G probably damaging Het
Otop3 A G 11: 115,345,000 D486G probably benign Het
Pak1ip1 A G 13: 41,009,255 K178R probably benign Het
Pcsk1 G A 13: 75,110,883 G259S probably benign Het
Pde6a A G 18: 61,249,960 D338G probably damaging Het
Pias4 A T 10: 81,163,972 D82E probably benign Het
Plekha5 C A 6: 140,570,333 Q771K probably benign Het
Plekhh3 C A 11: 101,165,579 A397S possibly damaging Het
Prg4 G T 1: 150,455,905 T339N unknown Het
Prss22 A T 17: 23,997,997 I3N probably damaging Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rspo2 T C 15: 43,078,114 T138A probably benign Het
Rtcb C T 10: 85,953,469 G70S probably benign Het
Selenov A T 7: 28,290,378 S234T probably damaging Het
Shtn1 T C 19: 59,003,860 T429A probably damaging Het
Slc4a3 G T 1: 75,553,377 R622L probably benign Het
Smarca1 T A X: 47,876,460 K301N possibly damaging Het
Smc2 T C 4: 52,478,448 I1015T probably damaging Het
Spata9 G T 13: 75,967,840 V3F possibly damaging Het
Tlr4 T C 4: 66,924,422 I105T probably benign Het
Trav6d-4 A T 14: 52,753,639 Y47F possibly damaging Het
Ttn A T 2: 76,827,033 I12450N unknown Het
Umad1 G T 6: 8,270,560 A21S probably damaging Het
Unc5a G A 13: 54,996,549 R229H probably benign Het
Vmn1r216 A T 13: 23,099,860 M238L probably damaging Het
Vps16 T A 2: 130,439,057 C255* probably null Het
Wdr89 A G 12: 75,632,614 F289L probably benign Het
Zfp180 A T 7: 24,106,100 H648L probably damaging Het
Zfp735 A G 11: 73,690,328 K64E possibly damaging Het
Zfp990 G A 4: 145,537,587 C385Y probably damaging Het
Zswim3 G T 2: 164,820,215 S205I probably damaging Het
Other mutations in Myh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Myh6 APN 14 54946993 missense probably benign 0.13
IGL00401:Myh6 APN 14 54953417 missense probably benign 0.00
IGL01062:Myh6 APN 14 54952292 missense probably damaging 0.99
IGL01300:Myh6 APN 14 54963091 missense possibly damaging 0.94
IGL01688:Myh6 APN 14 54963960 missense possibly damaging 0.74
IGL01695:Myh6 APN 14 54957413 missense probably benign 0.01
IGL01762:Myh6 APN 14 54962081 missense probably benign 0.17
IGL01803:Myh6 APN 14 54944543 missense probably damaging 1.00
IGL02079:Myh6 APN 14 54950541 missense probably damaging 1.00
IGL02315:Myh6 APN 14 54953834 missense probably damaging 1.00
IGL02340:Myh6 APN 14 54957155 missense possibly damaging 0.76
IGL02377:Myh6 APN 14 54944318 missense probably benign 0.10
IGL02715:Myh6 APN 14 54946908 unclassified probably benign
IGL02742:Myh6 APN 14 54953924 missense possibly damaging 0.62
P0028:Myh6 UTSW 14 54963637 missense probably benign
PIT4520001:Myh6 UTSW 14 54950124 missense probably benign 0.00
R0058:Myh6 UTSW 14 54963404 missense probably damaging 1.00
R0090:Myh6 UTSW 14 54958704 missense probably damaging 0.97
R0360:Myh6 UTSW 14 54948347 nonsense probably null
R0364:Myh6 UTSW 14 54948347 nonsense probably null
R0395:Myh6 UTSW 14 54946320 missense possibly damaging 0.94
R0549:Myh6 UTSW 14 54958608 missense probably damaging 1.00
R0559:Myh6 UTSW 14 54958554 missense probably benign
R0800:Myh6 UTSW 14 54953278 splice site probably benign
R0892:Myh6 UTSW 14 54947054 missense probably benign 0.17
R0975:Myh6 UTSW 14 54953369 missense probably damaging 1.00
R1051:Myh6 UTSW 14 54949527 missense probably benign 0.12
R1180:Myh6 UTSW 14 54944468 missense possibly damaging 0.93
R1311:Myh6 UTSW 14 54946365 missense probably damaging 0.96
R1490:Myh6 UTSW 14 54962718 nonsense probably null
R1531:Myh6 UTSW 14 54956506 missense probably damaging 1.00
R1835:Myh6 UTSW 14 54957401 missense probably benign 0.03
R1845:Myh6 UTSW 14 54944674 missense probably damaging 1.00
R2033:Myh6 UTSW 14 54963645 missense probably benign 0.00
R2143:Myh6 UTSW 14 54952954 missense probably damaging 1.00
R2146:Myh6 UTSW 14 54953771 missense probably damaging 1.00
R2155:Myh6 UTSW 14 54953794 missense probably benign
R2484:Myh6 UTSW 14 54961242 nonsense probably null
R3155:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3156:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3780:Myh6 UTSW 14 54963958 missense probably benign 0.00
R3906:Myh6 UTSW 14 54956955 missense probably benign 0.04
R3937:Myh6 UTSW 14 54963055 missense probably benign 0.00
R3938:Myh6 UTSW 14 54963055 missense probably benign 0.00
R4236:Myh6 UTSW 14 54960362 missense probably benign 0.15
R4373:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4374:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4377:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4798:Myh6 UTSW 14 54953293 missense probably damaging 1.00
R4844:Myh6 UTSW 14 54947194 missense possibly damaging 0.89
R4908:Myh6 UTSW 14 54956962 missense probably damaging 1.00
R5256:Myh6 UTSW 14 54952661 missense probably damaging 1.00
R5277:Myh6 UTSW 14 54956562 missense probably benign 0.01
R5356:Myh6 UTSW 14 54953762 missense probably damaging 1.00
R5433:Myh6 UTSW 14 54953924 missense probably benign 0.32
R5616:Myh6 UTSW 14 54956581 missense probably benign 0.17
R5784:Myh6 UTSW 14 54953064 missense possibly damaging 0.93
R5820:Myh6 UTSW 14 54958680 missense probably damaging 0.99
R5835:Myh6 UTSW 14 54950407 missense probably damaging 1.00
R5922:Myh6 UTSW 14 54946474 missense probably damaging 0.99
R5975:Myh6 UTSW 14 54950508 missense probably benign 0.31
R5988:Myh6 UTSW 14 54965394 missense probably damaging 1.00
R6630:Myh6 UTSW 14 54942001 missense probably benign 0.01
R6845:Myh6 UTSW 14 54944749 missense probably benign
R7009:Myh6 UTSW 14 54952292 missense probably damaging 0.99
R7154:Myh6 UTSW 14 54960307 missense probably benign 0.43
R7293:Myh6 UTSW 14 54947174 missense probably benign 0.00
R7313:Myh6 UTSW 14 54960270 missense probably benign 0.00
R7339:Myh6 UTSW 14 54961568 intron probably null
R7348:Myh6 UTSW 14 54952259 missense probably damaging 1.00
R7680:Myh6 UTSW 14 54948733 missense possibly damaging 0.88
R7726:Myh6 UTSW 14 54965365 missense probably damaging 0.99
R7743:Myh6 UTSW 14 54957150 missense probably damaging 0.99
R7807:Myh6 UTSW 14 54942440 missense probably damaging 1.00
Z1088:Myh6 UTSW 14 54956997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGAGACCTAGGCTGAAC -3'
(R):5'- GTGAGGCCACATGACTTTCTC -3'

Sequencing Primer
(F):5'- AGACCTAGGCTGAACCCGAG -3'
(R):5'- GAGGCCACATGACTTTCTCTTCTTTC -3'
Posted On2019-10-07