Mutagenetix > Incidental Mutation

Incidental Mutation 'R7487:Rspo2'

580286

Institutional Source

Beutler Lab

Gene Symbol

Rspo2

Ensembl Gene

ENSMUSG00000051920

Gene Name

R-spondin 2

Synonyms

2610028F08Rik, ftls

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7487 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43020794-43170826 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43078114 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 138 (T138A)

Ref Sequence

ENSEMBL: ENSMUSP00000067325 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063492] [ENSMUST00000226810]

AlphaFold

Q8BFU0

PDB Structure

Mouse ZNRF3 ectodomain in complex with mouse RSPO2 Fu1-Fu2 crystal form I [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000063492
AA Change: T138A

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000067325
Gene: ENSMUSG00000051920
AA Change: T138A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
FU	37	84	1.95e0	SMART
FU	90	134	3.7e-8	SMART
TSP1	147	204	7.45e-4	SMART
low complexity region	207	223	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000226810
AA Change: T138A

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (89/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R-spondin family of proteins. These proteins are secreted ligands of leucine-rich repeat containing G protein-coupled receptors that enhance Wnt signaling through the inhibition of ubiquitin E3 ligases. A chromosomal translocation including this locus that results in the formation of a gene fusion has been identified in multiple human cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mice display perinatal lethality, cleft palate, lung hypoplasia, asymmetric limb malformations and abnormal renal development. Heterozygous females display reduced fertility with age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	T	3: 138,066,868	D606V	probably damaging	Het
1700009N14Rik	T	A	4: 39,450,929	V45E	probably damaging	Het
2510009E07Rik	C	T	16: 21,653,729	V74M	probably damaging	Het
Abca2	C	T	2: 25,437,903	T739M	probably benign	Het
Abra	T	C	15: 41,869,553	E39G	probably damaging	Het
Adam34	A	T	8: 43,651,154	C485S	probably damaging	Het
Add2	G	T	6: 86,093,450	V175F	possibly damaging	Het
Alk	T	A	17: 71,949,898	K655N	probably benign	Het
Ap3m1	A	G	14: 21,038,039	V317A	probably benign	Het
Astn1	A	G	1: 158,610,782		probably null	Het
Atm	A	T	9: 53,524,354	Y219N	probably benign	Het
Cep128	C	T	12: 90,999,630	A1068T	probably benign	Het
Cnksr3	T	C	10: 7,135,097	Q250R	probably benign	Het
Cst7	A	G	2: 150,577,704	T97A	probably benign	Het
Ctps	G	A	4: 120,558,800	L209F	probably damaging	Het
Cyp2d10	A	T	15: 82,404,592	F230I	probably benign	Het
Daam2	T	C	17: 49,486,482	N336D	probably benign	Het
Dchs2	T	C	3: 83,356,306	S3294P	probably damaging	Het
Dhx36	G	T	3: 62,484,202	N574K	possibly damaging	Het
Dock10	G	T	1: 80,585,048	Q533K	probably benign	Het
Dync2h1	A	G	9: 7,132,041	S1589P	probably benign	Het
Enpp3	T	A	10: 24,805,923	Y295F	probably benign	Het
Esrrg	T	A	1: 188,146,423	Y234N	probably benign	Het
Fadd	A	C	7: 144,580,725	V141G	probably damaging	Het
Fam114a2	C	T	11: 57,513,689	G83D	probably damaging	Het
Fam170b	T	A	14: 32,835,819	C204S	probably damaging	Het
Fam186a	T	A	15: 99,942,136	I2076F	possibly damaging	Het
Fdxacb1	G	A	9: 50,770,219	V147I	possibly damaging	Het
Fopnl	T	C	16: 14,311,104	D85G	probably benign	Het
Frem2	C	A	3: 53,654,549	V846F	probably benign	Het
Fry	G	A	5: 150,414,574	S1449N	possibly damaging	Het
Gucy1b2	A	G	14: 62,448,223	F98L	probably damaging	Het
Hps1	T	C	19: 42,756,261	Y658C	probably damaging	Het
Igkv3-9	T	A	6: 70,588,522	L35Q	probably damaging	Het
Irx2	A	G	13: 72,630,620	Y101C	probably damaging	Het
Kcnj11	G	T	7: 46,098,841	R353S	probably benign	Het
Kyat3	C	T	3: 142,726,194	Q228*	probably null	Het
Lama3	T	A	18: 12,419,237	D415E	probably benign	Het
Lcn3	G	A	2: 25,766,162		probably null	Het
Lin7b	T	C	7: 45,369,940	E68G	possibly damaging	Het
Lmbr1	T	A	5: 29,254,264	K379M	probably benign	Het
Lrig1	A	G	6: 94,606,118	S1006P	probably benign	Het
Lrrc37a	T	G	11: 103,498,219	T2127P	unknown	Het
Map4	A	G	9: 110,027,715	D151G	probably damaging	Het
March1	A	T	8: 66,456,074	T149S	probably benign	Het
Msh4	A	T	3: 153,863,510	F809I	probably damaging	Het
Muc16	G	A	9: 18,584,799	P6699S	possibly damaging	Het
Mxi1	A	T	19: 53,371,657	D270V	probably damaging	Het
Myh6	A	T	14: 54,953,496	C907*	probably null	Het
Myo18b	T	C	5: 112,834,433	R1145G	possibly damaging	Het
Nkx2-6	A	C	14: 69,171,940	N47H	probably benign	Het
Nol7	G	A	13: 43,398,600	A66T	probably damaging	Het
Ntrk3	T	C	7: 78,250,713	N626S	probably damaging	Het
Nwd1	A	G	8: 72,666,638	Y77C	unknown	Het
Olfr1057	A	T	2: 86,375,131	Y94N	probably damaging	Het
Olfr109	G	T	17: 37,466,566	R120L	probably damaging	Het
Olfr1413	G	A	1: 92,573,795	G208D	possibly damaging	Het
Olfr358	A	C	2: 37,004,774	V280G	probably damaging	Het
Olfr892-ps1	A	G	9: 38,190,060	S112G	probably damaging	Het
Otop3	A	G	11: 115,345,000	D486G	probably benign	Het
Pak1ip1	A	G	13: 41,009,255	K178R	probably benign	Het
Pcsk1	G	A	13: 75,110,883	G259S	probably benign	Het
Pde6a	A	G	18: 61,249,960	D338G	probably damaging	Het
Pias4	A	T	10: 81,163,972	D82E	probably benign	Het
Plekha5	C	A	6: 140,570,333	Q771K	probably benign	Het
Plekhh3	C	A	11: 101,165,579	A397S	possibly damaging	Het
Prg4	G	T	1: 150,455,905	T339N	unknown	Het
Prss22	A	T	17: 23,997,997	I3N	probably damaging	Het
Rasgrp1	T	C	2: 117,287,943	I522V	probably damaging	Het
Rtcb	C	T	10: 85,953,469	G70S	probably benign	Het
Selenov	A	T	7: 28,290,378	S234T	probably damaging	Het
Shtn1	T	C	19: 59,003,860	T429A	probably damaging	Het
Slc4a3	G	T	1: 75,553,377	R622L	probably benign	Het
Smc2	T	C	4: 52,478,448	I1015T	probably damaging	Het
Spata9	G	T	13: 75,967,840	V3F	possibly damaging	Het
Tlr4	T	C	4: 66,924,422	I105T	probably benign	Het
Trav6d-4	A	T	14: 52,753,639	Y47F	possibly damaging	Het
Ttn	A	T	2: 76,827,033	I12450N	unknown	Het
Umad1	G	T	6: 8,270,560	A21S	probably damaging	Het
Unc5a	G	A	13: 54,996,549	R229H	probably benign	Het
Vmn1r216	A	T	13: 23,099,860	M238L	probably damaging	Het
Vps16	T	A	2: 130,439,057	C255*	probably null	Het
Wdr89	A	G	12: 75,632,614	F289L	probably benign	Het
Zfp180	A	T	7: 24,106,100	H648L	probably damaging	Het
Zfp735	A	G	11: 73,690,328	K64E	possibly damaging	Het
Zfp990	G	A	4: 145,537,587	C385Y	probably damaging	Het
Zswim3	G	T	2: 164,820,215	S205I	probably damaging	Het

Other mutations in Rspo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1505:Rspo2	UTSW	15	43075843	missense	probably damaging	1.00
R1866:Rspo2	UTSW	15	43075936	missense	probably damaging	1.00
R2913:Rspo2	UTSW	15	43078114	missense	probably benign	0.00
R4082:Rspo2	UTSW	15	43022537	missense	probably benign
R4256:Rspo2	UTSW	15	43075911	missense	probably benign	0.43
R4257:Rspo2	UTSW	15	43075911	missense	probably benign	0.43
R4422:Rspo2	UTSW	15	43169754	missense	probably benign
R4715:Rspo2	UTSW	15	43075904	nonsense	probably null
R4810:Rspo2	UTSW	15	43169820	missense	probably benign	0.24
R4829:Rspo2	UTSW	15	43093187	nonsense	probably null
R5720:Rspo2	UTSW	15	43169814	missense	probably benign	0.13
R5828:Rspo2	UTSW	15	43075887	missense	probably damaging	1.00
R7571:Rspo2	UTSW	15	43169976	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGCCCTTAAGTAGCCTAACTTG -3'
(R):5'- GCTTGAGGTAACCAATGCATAAC -3'

Sequencing Primer
(F):5'- TGAAACAAAGCTATCCATCATCATG -3'
(R):5'- CGAAGTGCAAAGTAGGCT -3'

Posted On

2019-10-07