Incidental Mutation 'R7488:Zfp451'
ID580302
Institutional Source Beutler Lab
Gene Symbol Zfp451
Ensembl Gene ENSMUSG00000042197
Gene Namezinc finger protein 451
Synonyms4930515K21Rik, Kiaa0576-hp, 4933435G09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7488 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location33761545-33814595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33779140 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 303 (R303H)
Ref Sequence ENSEMBL: ENSMUSP00000019861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019861] [ENSMUST00000115167] [ENSMUST00000139143] [ENSMUST00000151055] [ENSMUST00000194656]
Predicted Effect probably benign
Transcript: ENSMUST00000019861
AA Change: R303H

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000019861
Gene: ENSMUSG00000042197
AA Change: R303H

DomainStartEndE-ValueType
coiled coil region 81 109 N/A INTRINSIC
ZnF_C2H2 169 195 1.63e1 SMART
ZnF_C2H2 212 232 1.18e2 SMART
ZnF_C2H2 253 277 1.73e0 SMART
ZnF_C2H2 315 335 2.03e2 SMART
ZnF_C2H2 362 385 3.75e1 SMART
ZnF_C2H2 494 517 2.91e-2 SMART
ZnF_C2H2 527 550 5.4e1 SMART
low complexity region 558 577 N/A INTRINSIC
ZnF_C2H2 604 629 1.55e1 SMART
ZnF_C2H2 634 657 2.29e0 SMART
ZnF_C2H2 665 687 1.64e-1 SMART
ZnF_C2H2 751 774 6.75e0 SMART
ZnF_C2H2 787 810 4.94e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115167
AA Change: R86H

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110821
Gene: ENSMUSG00000042197
AA Change: R86H

DomainStartEndE-ValueType
coiled coil region 81 109 N/A INTRINSIC
ZnF_C2H2 169 195 1.63e1 SMART
ZnF_C2H2 212 232 1.18e2 SMART
ZnF_C2H2 253 277 1.73e0 SMART
ZnF_C2H2 315 335 2.03e2 SMART
ZnF_C2H2 362 385 3.75e1 SMART
ZnF_C2H2 494 517 2.91e-2 SMART
ZnF_C2H2 527 550 5.4e1 SMART
low complexity region 558 577 N/A INTRINSIC
ZnF_C2H2 604 629 1.55e1 SMART
ZnF_C2H2 634 657 2.29e0 SMART
ZnF_C2H2 665 687 1.64e-1 SMART
ZnF_C2H2 751 774 6.75e0 SMART
ZnF_C2H2 787 810 4.94e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139143
Predicted Effect probably benign
Transcript: ENSMUST00000151055
Predicted Effect probably benign
Transcript: ENSMUST00000194656
SMART Domains Protein: ENSMUSP00000141813
Gene: ENSMUSG00000042197

DomainStartEndE-ValueType
ZnF_C2H2 127 153 6.9e-2 SMART
ZnF_C2H2 170 190 5e-1 SMART
ZnF_C2H2 211 235 7.2e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A G 8: 45,962,294 V225A probably benign Het
1810046K07Rik C A 9: 51,290,060 R232L probably damaging Het
2700049A03Rik T A 12: 71,150,405 F251I possibly damaging Het
4931408C20Rik T C 1: 26,683,958 T714A possibly damaging Het
Abcb11 C T 2: 69,277,802 G717D probably benign Het
Abcc1 G A 16: 14,389,899 W47* probably null Het
Ahnak2 A G 12: 112,785,021 I402T Het
Ankfy1 G A 11: 72,759,943 R984Q probably benign Het
Apaf1 A G 10: 91,054,380 I598T probably benign Het
Apobec1 G T 6: 122,581,562 P78Q possibly damaging Het
Asap1 A T 15: 64,120,125 I737N probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Bcr A C 10: 75,160,330 D902A possibly damaging Het
Bicra T C 7: 15,989,442 probably null Het
Ccdc27 T C 4: 154,032,967 T508A probably benign Het
Ccz1 T A 5: 143,991,583 N383I probably damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Cdhr2 T C 13: 54,717,915 I242T probably benign Het
Cdk4 T A 10: 127,064,237 M1K probably null Het
Cntn5 A T 9: 9,970,565 S302T probably damaging Het
Col25a1 G T 3: 130,584,701 G601V probably damaging Het
Cpb1 A G 3: 20,270,324 L62P possibly damaging Het
Cpne1 T C 2: 156,077,937 T264A probably benign Het
Cpvl T A 6: 53,947,742 N198Y probably damaging Het
Cyp2u1 A C 3: 131,297,947 L308R probably damaging Het
Ddx54 G T 5: 120,624,724 V637L probably benign Het
Dglucy C A 12: 100,857,051 P472T possibly damaging Het
Dync2h1 A G 9: 7,124,855 Y2006H probably benign Het
Eif5b T C 1: 38,050,306 M1121T possibly damaging Het
Emsy A G 7: 98,615,555 V545A possibly damaging Het
Ezh1 G A 11: 101,200,900 L480F possibly damaging Het
Fbln2 T A 6: 91,265,863 probably null Het
Gja10 T A 4: 32,602,058 K109* probably null Het
Gm28042 A G 2: 120,039,957 N762S probably benign Het
Gnb1l C A 16: 18,540,470 P7Q possibly damaging Het
Grem2 A T 1: 174,837,119 S55T probably damaging Het
Gsn A T 2: 35,296,421 N393I possibly damaging Het
H6pd T A 4: 149,982,636 Q439L probably benign Het
Hmcn2 G A 2: 31,420,830 G3362E probably damaging Het
Ighv11-2 T C 12: 114,048,358 Y79C probably damaging Het
Ikzf2 T A 1: 69,539,385 N322Y probably benign Het
Il25 A G 14: 54,933,002 I11V probably benign Het
Jak2 C T 19: 29,298,383 T741I probably damaging Het
Kdm3b T C 18: 34,824,881 S1300P probably damaging Het
Ldb3 T A 14: 34,567,445 Q268L probably damaging Het
Lrrc23 T A 6: 124,779,112 D6V unknown Het
Megf10 A G 18: 57,191,115 Y76C probably damaging Het
Neb A T 2: 52,220,221 M205K probably benign Het
Olfr1120 T C 2: 87,358,253 S270P probably damaging Het
Olfr151 A G 9: 37,730,687 S99P probably damaging Het
Olfr769 G T 10: 129,111,736 Q230K probably benign Het
Pcnx3 G A 19: 5,667,459 R1541W possibly damaging Het
Pdgfd A G 9: 6,359,739 Y270C probably damaging Het
Pds5b A T 5: 150,723,337 D197V probably damaging Het
Pknox2 A G 9: 36,954,831 M30T probably benign Het
Plekhg1 A T 10: 3,957,491 S858C Het
Por A T 5: 135,733,644 E400D probably benign Het
Psip1 A G 4: 83,473,038 probably null Het
Retreg1 G T 15: 25,889,542 V111F Het
Rock1 G A 18: 10,122,762 A353V probably damaging Het
Rpl6 C G 5: 121,208,528 R231G probably benign Het
Scn7a C T 2: 66,757,230 R43H probably benign Het
Scnn1g T A 7: 121,763,434 N488K probably benign Het
Slc24a1 A G 9: 64,924,482 V1111A probably benign Het
Snapc1 C T 12: 73,982,511 S356L probably benign Het
Ssbp2 T A 13: 91,675,090 N201K probably damaging Het
Tfdp2 A G 9: 96,297,642 N43D probably damaging Het
Tmprss11d A G 5: 86,326,450 I216T probably damaging Het
Tmprss4 A G 9: 45,175,555 S303P probably benign Het
Tnpo2 A G 8: 85,055,034 E815G probably benign Het
Trav6-1 A C 14: 52,638,515 M1L possibly damaging Het
Trpm3 T C 19: 22,978,573 V1133A probably damaging Het
Trpv1 C T 11: 73,238,529 P91S probably benign Het
Trpv2 T C 11: 62,589,750 Y338H probably damaging Het
Txnip T C 3: 96,560,223 M336T probably benign Het
Vmn1r61 A T 7: 5,610,768 H182Q possibly damaging Het
Vmn2r105 A G 17: 20,208,783 V677A probably damaging Het
Wwp1 G T 4: 19,627,660 T745K probably damaging Het
Xkr5 C A 8: 18,933,592 E645* probably null Het
Zyg11b T C 4: 108,266,458 H104R possibly damaging Het
Other mutations in Zfp451
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Zfp451 APN 1 33786540 intron probably benign
IGL00423:Zfp451 APN 1 33777579 missense probably benign 0.44
IGL00925:Zfp451 APN 1 33776261 unclassified probably benign
IGL00971:Zfp451 APN 1 33783153 missense probably benign 0.01
IGL01521:Zfp451 APN 1 33777331 splice site probably null
IGL01672:Zfp451 APN 1 33762166 missense probably benign 0.33
IGL01826:Zfp451 APN 1 33782162 missense probably damaging 1.00
IGL02298:Zfp451 APN 1 33772921 missense probably damaging 0.98
IGL02343:Zfp451 APN 1 33776493 missense probably damaging 1.00
IGL03150:Zfp451 APN 1 33777454 missense probably damaging 1.00
IGL03257:Zfp451 APN 1 33777048 missense possibly damaging 0.90
R0006:Zfp451 UTSW 1 33802780 intron probably benign
R0068:Zfp451 UTSW 1 33777625 missense probably damaging 1.00
R0068:Zfp451 UTSW 1 33777625 missense probably damaging 1.00
R0358:Zfp451 UTSW 1 33777729 missense probably damaging 1.00
R0441:Zfp451 UTSW 1 33777045 missense probably damaging 0.96
R0483:Zfp451 UTSW 1 33770910 splice site probably benign
R0745:Zfp451 UTSW 1 33770848 nonsense probably null
R1469:Zfp451 UTSW 1 33769813 missense possibly damaging 0.93
R1469:Zfp451 UTSW 1 33769813 missense possibly damaging 0.93
R1486:Zfp451 UTSW 1 33777727 missense probably damaging 0.99
R1774:Zfp451 UTSW 1 33813768 missense probably benign 0.02
R1929:Zfp451 UTSW 1 33782193 missense probably damaging 1.00
R1929:Zfp451 UTSW 1 33783856 missense probably benign 0.12
R1933:Zfp451 UTSW 1 33777822 missense probably damaging 1.00
R2108:Zfp451 UTSW 1 33779167 missense possibly damaging 0.93
R2225:Zfp451 UTSW 1 33770907 splice site probably benign
R2372:Zfp451 UTSW 1 33780052 splice site probably null
R3923:Zfp451 UTSW 1 33779045 missense probably null 1.00
R4295:Zfp451 UTSW 1 33777755 missense probably damaging 0.99
R4409:Zfp451 UTSW 1 33777413 missense probably damaging 1.00
R4617:Zfp451 UTSW 1 33802671 intron probably benign
R4757:Zfp451 UTSW 1 33765858 missense probably damaging 0.98
R4777:Zfp451 UTSW 1 33782105 missense possibly damaging 0.80
R4906:Zfp451 UTSW 1 33805384 missense probably damaging 1.00
R4964:Zfp451 UTSW 1 33777861 missense probably damaging 1.00
R5128:Zfp451 UTSW 1 33802933 intron probably benign
R5129:Zfp451 UTSW 1 33802933 intron probably benign
R5383:Zfp451 UTSW 1 33813806 missense probably damaging 1.00
R5446:Zfp451 UTSW 1 33777528 missense probably damaging 1.00
R6154:Zfp451 UTSW 1 33803546 intron probably benign
R6228:Zfp451 UTSW 1 33803138 intron probably benign
R6272:Zfp451 UTSW 1 33803244 intron probably benign
R6296:Zfp451 UTSW 1 33769817 nonsense probably null
R6321:Zfp451 UTSW 1 33813735 missense probably damaging 1.00
R6445:Zfp451 UTSW 1 33773011 missense probably damaging 1.00
R6528:Zfp451 UTSW 1 33777781 missense probably damaging 1.00
R6562:Zfp451 UTSW 1 33762179 missense possibly damaging 0.90
R6739:Zfp451 UTSW 1 33803594 intron probably benign
R6911:Zfp451 UTSW 1 33803456 intron probably benign
R7042:Zfp451 UTSW 1 33777393 missense probably damaging 1.00
R7044:Zfp451 UTSW 1 33802167 intron probably benign
R7071:Zfp451 UTSW 1 33776744 missense possibly damaging 0.96
R7082:Zfp451 UTSW 1 33772891 critical splice donor site probably null
R7123:Zfp451 UTSW 1 33776869 missense probably damaging 1.00
R7149:Zfp451 UTSW 1 33777324 missense probably damaging 1.00
R7179:Zfp451 UTSW 1 33802570 missense unknown
R7185:Zfp451 UTSW 1 33769893 missense probably damaging 1.00
R7228:Zfp451 UTSW 1 33803394 missense unknown
R7402:Zfp451 UTSW 1 33813762 missense probably benign
R7462:Zfp451 UTSW 1 33777013 missense probably damaging 1.00
R7507:Zfp451 UTSW 1 33769759 missense probably damaging 1.00
R7774:Zfp451 UTSW 1 33805393 missense probably benign 0.20
R7835:Zfp451 UTSW 1 33772979 missense probably damaging 1.00
R7979:Zfp451 UTSW 1 33782138 missense probably benign 0.01
R8123:Zfp451 UTSW 1 33762167 missense possibly damaging 0.92
R8137:Zfp451 UTSW 1 33782075 missense possibly damaging 0.57
RF005:Zfp451 UTSW 1 33776792 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAACAGGAGATTTGCCTAACCC -3'
(R):5'- ACAGTGTGTTTATTGCACCTGG -3'

Sequencing Primer
(F):5'- CTTCCCCTACTGAAGATGTTACCAGG -3'
(R):5'- ATTGGATCAGAAGGCACTCTTTG -3'
Posted On2019-10-07