Incidental Mutation 'R7488:Abcb11'
ID580310
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 11
SynonymsPFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
MMRRC Submission
Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R7488 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location69238282-69342616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69277802 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 717 (G717D)
Ref Sequence ENSEMBL: ENSMUSP00000099771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
Predicted Effect probably benign
Transcript: ENSMUST00000102709
AA Change: G717D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: G717D

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102710
AA Change: G717D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: G717D

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180142
AA Change: G717D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: G717D

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A G 8: 45,962,294 V225A probably benign Het
1810046K07Rik C A 9: 51,290,060 R232L probably damaging Het
2700049A03Rik T A 12: 71,150,405 F251I possibly damaging Het
4931408C20Rik T C 1: 26,683,958 T714A possibly damaging Het
Abcc1 G A 16: 14,389,899 W47* probably null Het
Ahnak2 A G 12: 112,785,021 I402T Het
Ankfy1 G A 11: 72,759,943 R984Q probably benign Het
Apaf1 A G 10: 91,054,380 I598T probably benign Het
Apobec1 G T 6: 122,581,562 P78Q possibly damaging Het
Asap1 A T 15: 64,120,125 I737N probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Bcr A C 10: 75,160,330 D902A possibly damaging Het
Bicra T C 7: 15,989,442 probably null Het
Ccdc27 T C 4: 154,032,967 T508A probably benign Het
Ccz1 T A 5: 143,991,583 N383I probably damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Cdhr2 T C 13: 54,717,915 I242T probably benign Het
Cdk4 T A 10: 127,064,237 M1K probably null Het
Cntn5 A T 9: 9,970,565 S302T probably damaging Het
Col25a1 G T 3: 130,584,701 G601V probably damaging Het
Cpb1 A G 3: 20,270,324 L62P possibly damaging Het
Cpne1 T C 2: 156,077,937 T264A probably benign Het
Cpvl T A 6: 53,947,742 N198Y probably damaging Het
Cyp2u1 A C 3: 131,297,947 L308R probably damaging Het
Ddx54 G T 5: 120,624,724 V637L probably benign Het
Dglucy C A 12: 100,857,051 P472T possibly damaging Het
Dync2h1 A G 9: 7,124,855 Y2006H probably benign Het
Eif5b T C 1: 38,050,306 M1121T possibly damaging Het
Emsy A G 7: 98,615,555 V545A possibly damaging Het
Ezh1 G A 11: 101,200,900 L480F possibly damaging Het
Fbln2 T A 6: 91,265,863 probably null Het
Gja10 T A 4: 32,602,058 K109* probably null Het
Gm28042 A G 2: 120,039,957 N762S probably benign Het
Gnb1l C A 16: 18,540,470 P7Q possibly damaging Het
Grem2 A T 1: 174,837,119 S55T probably damaging Het
Gsn A T 2: 35,296,421 N393I possibly damaging Het
H6pd T A 4: 149,982,636 Q439L probably benign Het
Hmcn2 G A 2: 31,420,830 G3362E probably damaging Het
Ighv11-2 T C 12: 114,048,358 Y79C probably damaging Het
Ikzf2 T A 1: 69,539,385 N322Y probably benign Het
Il25 A G 14: 54,933,002 I11V probably benign Het
Jak2 C T 19: 29,298,383 T741I probably damaging Het
Kdm3b T C 18: 34,824,881 S1300P probably damaging Het
Ldb3 T A 14: 34,567,445 Q268L probably damaging Het
Lrrc23 T A 6: 124,779,112 D6V unknown Het
Megf10 A G 18: 57,191,115 Y76C probably damaging Het
Neb A T 2: 52,220,221 M205K probably benign Het
Olfr1120 T C 2: 87,358,253 S270P probably damaging Het
Olfr151 A G 9: 37,730,687 S99P probably damaging Het
Olfr769 G T 10: 129,111,736 Q230K probably benign Het
Pcnx3 G A 19: 5,667,459 R1541W possibly damaging Het
Pdgfd A G 9: 6,359,739 Y270C probably damaging Het
Pds5b A T 5: 150,723,337 D197V probably damaging Het
Pknox2 A G 9: 36,954,831 M30T probably benign Het
Plekhg1 A T 10: 3,957,491 S858C Het
Por A T 5: 135,733,644 E400D probably benign Het
Psip1 A G 4: 83,473,038 probably null Het
Retreg1 G T 15: 25,889,542 V111F Het
Rock1 G A 18: 10,122,762 A353V probably damaging Het
Rpl6 C G 5: 121,208,528 R231G probably benign Het
Scn7a C T 2: 66,757,230 R43H probably benign Het
Scnn1g T A 7: 121,763,434 N488K probably benign Het
Slc24a1 A G 9: 64,924,482 V1111A probably benign Het
Snapc1 C T 12: 73,982,511 S356L probably benign Het
Ssbp2 T A 13: 91,675,090 N201K probably damaging Het
Tfdp2 A G 9: 96,297,642 N43D probably damaging Het
Tmprss11d A G 5: 86,326,450 I216T probably damaging Het
Tmprss4 A G 9: 45,175,555 S303P probably benign Het
Tnpo2 A G 8: 85,055,034 E815G probably benign Het
Trav6-1 A C 14: 52,638,515 M1L possibly damaging Het
Trpm3 T C 19: 22,978,573 V1133A probably damaging Het
Trpv1 C T 11: 73,238,529 P91S probably benign Het
Trpv2 T C 11: 62,589,750 Y338H probably damaging Het
Txnip T C 3: 96,560,223 M336T probably benign Het
Vmn1r61 A T 7: 5,610,768 H182Q possibly damaging Het
Vmn2r105 A G 17: 20,208,783 V677A probably damaging Het
Wwp1 G T 4: 19,627,660 T745K probably damaging Het
Xkr5 C A 8: 18,933,592 E645* probably null Het
Zfp451 C T 1: 33,779,140 R303H probably benign Het
Zyg11b T C 4: 108,266,458 H104R possibly damaging Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69284681 missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69245944 missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69296409 missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69287592 splice site probably benign
IGL01885:Abcb11 APN 2 69287627 missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69287612 missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69243498 missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69323825 splice site probably benign
IGL02119:Abcb11 APN 2 69328000 critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69257310 missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69299925 missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69248889 missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69265457 nonsense probably null
IGL02505:Abcb11 APN 2 69245761 missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69306605 missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69284682 missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69291999 nonsense probably null
IGL03181:Abcb11 APN 2 69328008 intron probably benign
3-1:Abcb11 UTSW 2 69327993 missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69243518 missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69285308 missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69286666 missense probably null 0.82
R0413:Abcb11 UTSW 2 69328011 intron probably benign
R0437:Abcb11 UTSW 2 69257295 missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69277884 splice site probably benign
R0646:Abcb11 UTSW 2 69285283 missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69329318 missense probably benign 0.15
R0856:Abcb11 UTSW 2 69323918 missense probably benign
R1061:Abcb11 UTSW 2 69277809 missense probably benign 0.00
R1460:Abcb11 UTSW 2 69257374 splice site probably benign
R1714:Abcb11 UTSW 2 69306581 missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69261566 missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69245923 missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69282670 splice site probably null
R2086:Abcb11 UTSW 2 69259476 splice site probably benign
R2133:Abcb11 UTSW 2 69323883 missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69329329 missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69257358 missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69329376 splice site probably benign
R3772:Abcb11 UTSW 2 69329376 splice site probably benign
R3979:Abcb11 UTSW 2 69323976 missense probably benign 0.11
R4227:Abcb11 UTSW 2 69284776 missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69306605 missense probably benign 0.03
R4614:Abcb11 UTSW 2 69284681 missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69285271 missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69259627 missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69323962 missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69245867 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69239196 missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69323892 missense probably benign 0.12
R5028:Abcb11 UTSW 2 69274012 missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69308506 missense probably benign 0.06
R5177:Abcb11 UTSW 2 69285295 missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69286847 missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69245764 missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69261500 missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69243467 missense probably benign 0.43
R6252:Abcb11 UTSW 2 69291961 missense probably benign 0.10
R6389:Abcb11 UTSW 2 69323894 missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69282652 missense probably benign
R6590:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69286846 missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69285298 missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69265675 missense probably benign
R7223:Abcb11 UTSW 2 69274143 missense probably benign
R7323:Abcb11 UTSW 2 69287635 missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69245769 missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69287619 missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69303936 critical splice donor site probably null
R7544:Abcb11 UTSW 2 69265486 missense probably benign 0.05
R7660:Abcb11 UTSW 2 69287594 splice site probably null
R7754:Abcb11 UTSW 2 69286818 missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69239191 missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69286678 missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R7836:Abcb11 UTSW 2 69323873 small deletion probably benign
R7842:Abcb11 UTSW 2 69323873 small deletion probably benign
R7894:Abcb11 UTSW 2 69323873 small deletion probably benign
R7896:Abcb11 UTSW 2 69323873 small deletion probably benign
R7897:Abcb11 UTSW 2 69323872 frame shift probably null
R7897:Abcb11 UTSW 2 69323873 small deletion probably benign
R7898:Abcb11 UTSW 2 69323873 small deletion probably benign
R7917:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R8004:Abcb11 UTSW 2 69257210 missense possibly damaging 0.68
X0058:Abcb11 UTSW 2 69289443 missense probably benign 0.12
X0062:Abcb11 UTSW 2 69245906 missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69299866 missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69291981 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69306529 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69329269 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTTTTCACCAGTCCTAAAGCTCTC -3'
(R):5'- CCTAAGTTGGAAGCTCCCTG -3'

Sequencing Primer
(F):5'- AAAGCTCTCCTATTTGGTCTGAC -3'
(R):5'- TGGTTGTCACGTGACCCAC -3'
Posted On2019-10-07