Incidental Mutation 'R7488:Por'
ID580327
Institutional Source Beutler Lab
Gene Symbol Por
Ensembl Gene ENSMUSG00000005514
Gene NameP450 (cytochrome) oxidoreductase
SynonymsNADH cytochrome P450 oxydoreductase, CYPOR, CPR, 4933424M13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7488 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location135670033-135735326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135733644 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 400 (E400D)
Ref Sequence ENSEMBL: ENSMUSP00000005651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005651] [ENSMUST00000043378] [ENSMUST00000122113] [ENSMUST00000127096] [ENSMUST00000153399] [ENSMUST00000153500] [ENSMUST00000153515]
Predicted Effect probably benign
Transcript: ENSMUST00000005651
AA Change: E400D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005651
Gene: ENSMUSG00000005514
AA Change: E400D

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 1.6e-40 PFAM
Pfam:FAD_binding_1 274 493 1.3e-84 PFAM
Pfam:NAD_binding_1 530 642 2.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043378
SMART Domains Protein: ENSMUSP00000045252
Gene: ENSMUSG00000039886

DomainStartEndE-ValueType
Pfam:TMPIT 13 336 4.2e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122113
AA Change: E400D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000112924
Gene: ENSMUSG00000005514
AA Change: E400D

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 2.6e-40 PFAM
Pfam:FAD_binding_1 274 493 5.1e-87 PFAM
Pfam:NAD_binding_1 530 605 3.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127096
SMART Domains Protein: ENSMUSP00000119138
Gene: ENSMUSG00000005514

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
Pfam:Flavodoxin_1 127 168 5.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153399
SMART Domains Protein: ENSMUSP00000120834
Gene: ENSMUSG00000039886

DomainStartEndE-ValueType
Pfam:TMPIT 12 93 9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153500
SMART Domains Protein: ENSMUSP00000121531
Gene: ENSMUSG00000005514

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 5.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153515
SMART Domains Protein: ENSMUSP00000121022
Gene: ENSMUSG00000005514

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 3.2e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum membrane oxidoreductase with an FAD-binding domain and a flavodoxin-like domain. The protein binds two cofactors, FAD and FMN, which allow it to donate electrons directly from NADPH to all microsomal P450 enzymes. Mutations in this gene have been associated with various diseases, including apparent combined P450C17 and P450C21 deficiency, amenorrhea and disordered steroidogenesis, congenital adrenal hyperplasia and Antley-Bixler syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects of the neural tube, eye, heart, and limbs, retarded growth, and prenatal lethality. Liver-specific knockouts exhibit increased liver weight, hepatic lipidosis, and impaired drug metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A G 8: 45,962,294 V225A probably benign Het
1810046K07Rik C A 9: 51,290,060 R232L probably damaging Het
2700049A03Rik T A 12: 71,150,405 F251I possibly damaging Het
4931408C20Rik T C 1: 26,683,958 T714A possibly damaging Het
Abcb11 C T 2: 69,277,802 G717D probably benign Het
Abcc1 G A 16: 14,389,899 W47* probably null Het
Ahnak2 A G 12: 112,785,021 I402T Het
Ankfy1 G A 11: 72,759,943 R984Q probably benign Het
Apaf1 A G 10: 91,054,380 I598T probably benign Het
Apobec1 G T 6: 122,581,562 P78Q possibly damaging Het
Asap1 A T 15: 64,120,125 I737N probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Bcr A C 10: 75,160,330 D902A possibly damaging Het
Bicra T C 7: 15,989,442 probably null Het
Ccdc27 T C 4: 154,032,967 T508A probably benign Het
Ccz1 T A 5: 143,991,583 N383I probably damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Cdhr2 T C 13: 54,717,915 I242T probably benign Het
Cdk4 T A 10: 127,064,237 M1K probably null Het
Cntn5 A T 9: 9,970,565 S302T probably damaging Het
Col25a1 G T 3: 130,584,701 G601V probably damaging Het
Cpb1 A G 3: 20,270,324 L62P possibly damaging Het
Cpne1 T C 2: 156,077,937 T264A probably benign Het
Cpvl T A 6: 53,947,742 N198Y probably damaging Het
Cyp2u1 A C 3: 131,297,947 L308R probably damaging Het
Ddx54 G T 5: 120,624,724 V637L probably benign Het
Dglucy C A 12: 100,857,051 P472T possibly damaging Het
Dync2h1 A G 9: 7,124,855 Y2006H probably benign Het
Eif5b T C 1: 38,050,306 M1121T possibly damaging Het
Emsy A G 7: 98,615,555 V545A possibly damaging Het
Ezh1 G A 11: 101,200,900 L480F possibly damaging Het
Fbln2 T A 6: 91,265,863 probably null Het
Gja10 T A 4: 32,602,058 K109* probably null Het
Gm28042 A G 2: 120,039,957 N762S probably benign Het
Gnb1l C A 16: 18,540,470 P7Q possibly damaging Het
Grem2 A T 1: 174,837,119 S55T probably damaging Het
Gsn A T 2: 35,296,421 N393I possibly damaging Het
H6pd T A 4: 149,982,636 Q439L probably benign Het
Hmcn2 G A 2: 31,420,830 G3362E probably damaging Het
Ighv11-2 T C 12: 114,048,358 Y79C probably damaging Het
Ikzf2 T A 1: 69,539,385 N322Y probably benign Het
Il25 A G 14: 54,933,002 I11V probably benign Het
Jak2 C T 19: 29,298,383 T741I probably damaging Het
Kdm3b T C 18: 34,824,881 S1300P probably damaging Het
Ldb3 T A 14: 34,567,445 Q268L probably damaging Het
Lrrc23 T A 6: 124,779,112 D6V unknown Het
Megf10 A G 18: 57,191,115 Y76C probably damaging Het
Neb A T 2: 52,220,221 M205K probably benign Het
Olfr1120 T C 2: 87,358,253 S270P probably damaging Het
Olfr151 A G 9: 37,730,687 S99P probably damaging Het
Olfr769 G T 10: 129,111,736 Q230K probably benign Het
Pcnx3 G A 19: 5,667,459 R1541W possibly damaging Het
Pdgfd A G 9: 6,359,739 Y270C probably damaging Het
Pds5b A T 5: 150,723,337 D197V probably damaging Het
Pknox2 A G 9: 36,954,831 M30T probably benign Het
Plekhg1 A T 10: 3,957,491 S858C Het
Psip1 A G 4: 83,473,038 probably null Het
Retreg1 G T 15: 25,889,542 V111F Het
Rock1 G A 18: 10,122,762 A353V probably damaging Het
Rpl6 C G 5: 121,208,528 R231G probably benign Het
Scn7a C T 2: 66,757,230 R43H probably benign Het
Scnn1g T A 7: 121,763,434 N488K probably benign Het
Slc24a1 A G 9: 64,924,482 V1111A probably benign Het
Snapc1 C T 12: 73,982,511 S356L probably benign Het
Ssbp2 T A 13: 91,675,090 N201K probably damaging Het
Tfdp2 A G 9: 96,297,642 N43D probably damaging Het
Tmprss11d A G 5: 86,326,450 I216T probably damaging Het
Tmprss4 A G 9: 45,175,555 S303P probably benign Het
Tnpo2 A G 8: 85,055,034 E815G probably benign Het
Trav6-1 A C 14: 52,638,515 M1L possibly damaging Het
Trpm3 T C 19: 22,978,573 V1133A probably damaging Het
Trpv1 C T 11: 73,238,529 P91S probably benign Het
Trpv2 T C 11: 62,589,750 Y338H probably damaging Het
Txnip T C 3: 96,560,223 M336T probably benign Het
Vmn1r61 A T 7: 5,610,768 H182Q possibly damaging Het
Vmn2r105 A G 17: 20,208,783 V677A probably damaging Het
Wwp1 G T 4: 19,627,660 T745K probably damaging Het
Xkr5 C A 8: 18,933,592 E645* probably null Het
Zfp451 C T 1: 33,779,140 R303H probably benign Het
Zyg11b T C 4: 108,266,458 H104R possibly damaging Het
Other mutations in Por
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Por APN 5 135734186 nonsense probably null
IGL02126:Por APN 5 135715975 missense probably benign 0.00
R0201:Por UTSW 5 135731178 missense possibly damaging 0.94
R0355:Por UTSW 5 135732584 missense probably benign 0.38
R1755:Por UTSW 5 135729485 nonsense probably null
R1886:Por UTSW 5 135734274 missense probably damaging 1.00
R4057:Por UTSW 5 135731574 missense probably damaging 1.00
R4282:Por UTSW 5 135715961 missense possibly damaging 0.48
R4761:Por UTSW 5 135725930 intron probably benign
R5057:Por UTSW 5 135730902 missense probably damaging 1.00
R5064:Por UTSW 5 135733795 missense probably benign 0.23
R5159:Por UTSW 5 135730917 missense probably benign 0.38
R5580:Por UTSW 5 135733821 missense probably damaging 0.98
R5895:Por UTSW 5 135715984 missense probably benign 0.03
R7225:Por UTSW 5 135732587 missense probably benign
R7422:Por UTSW 5 135734919 missense probably benign 0.06
R7461:Por UTSW 5 135729504 missense probably damaging 0.99
R7613:Por UTSW 5 135729504 missense probably damaging 0.99
R7649:Por UTSW 5 135734505 missense probably damaging 0.99
R7736:Por UTSW 5 135731122 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTTGAGCCTTGTCACACAC -3'
(R):5'- GAATGGCTAGGATGTGCCTC -3'

Sequencing Primer
(F):5'- TTGTCACACACAGTCAGGG -3'
(R):5'- CTCCGGGCCTCCACCAC -3'
Posted On2019-10-07