Incidental Mutation 'R0633:Thsd7b'
ID 58033
Institutional Source Beutler Lab
Gene Symbol Thsd7b
Ensembl Gene ENSMUSG00000042581
Gene Name thrombospondin, type I, domain containing 7B
Synonyms 1700074E13Rik, D130067I03Rik
MMRRC Submission 038822-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R0633 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 129201039-130147015 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130116263 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1339 (S1339P)
Ref Sequence ENSEMBL: ENSMUSP00000073220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073527]
AlphaFold Q6P4U0
Predicted Effect possibly damaging
Transcript: ENSMUST00000073527
AA Change: S1339P

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: S1339P

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 5e-29 BLAST
Blast:TSP1 122 177 9e-24 BLAST
TSP1 182 233 2.47e-9 SMART
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 2e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 6e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1059 3.96e-8 SMART
TSP1 1062 1126 1.73e0 SMART
TSP1 1131 1182 6.05e-4 SMART
TSP1 1185 1246 9.52e-1 SMART
TSP1 1251 1303 3.21e-8 SMART
TSP1 1304 1369 5.52e-1 SMART
TSP1 1374 1432 3.92e-2 SMART
transmembrane domain 1558 1580 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140834
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 A T 9: 30,854,807 (GRCm39) R18S probably damaging Het
Adgb G A 10: 10,267,473 (GRCm39) A923V probably benign Het
Aldh1a3 A G 7: 66,049,970 (GRCm39) V416A probably damaging Het
Alox5 C T 6: 116,397,345 (GRCm39) G280R probably damaging Het
Anapc5 A T 5: 122,938,695 (GRCm39) Y360N probably damaging Het
Apbb1 C T 7: 105,208,170 (GRCm39) V685I probably damaging Het
Apc2 C A 10: 80,143,289 (GRCm39) A463E probably damaging Het
Arhgap21 C T 2: 20,860,198 (GRCm39) W1170* probably null Het
Atat1 G A 17: 36,212,315 (GRCm39) R305C probably damaging Het
Brd8dc A G 18: 34,719,319 (GRCm39) V167A possibly damaging Het
Cars2 T C 8: 11,600,511 (GRCm39) D56G probably benign Het
Ccdc202 T G 14: 96,119,379 (GRCm39) N45K probably damaging Het
Cdc42bpb T C 12: 111,311,989 (GRCm39) I108V probably damaging Het
Cftr T A 6: 18,305,979 (GRCm39) I1255K probably damaging Het
Ckap5 T C 2: 91,381,088 (GRCm39) L148P probably damaging Het
Cntn4 A G 6: 106,656,209 (GRCm39) probably null Het
Cpe G A 8: 65,062,237 (GRCm39) P273L probably damaging Het
Cpsf7 A G 19: 10,509,146 (GRCm39) D19G probably benign Het
Ddx25 C A 9: 35,457,268 (GRCm39) R349L probably damaging Het
Depdc7 T C 2: 104,553,226 (GRCm39) D446G probably benign Het
Det1 T A 7: 78,493,683 (GRCm39) N107I probably benign Het
Dock6 A T 9: 21,755,713 (GRCm39) D170E probably benign Het
Dvl1 C T 4: 155,942,752 (GRCm39) L673F probably damaging Het
Gucy1b1 A T 3: 81,952,767 (GRCm39) I222K probably benign Het
Hfm1 T C 5: 107,065,467 (GRCm39) T71A possibly damaging Het
Ikzf1 A G 11: 11,719,223 (GRCm39) E310G probably damaging Het
Impg1 T C 9: 80,301,437 (GRCm39) E163G possibly damaging Het
Itpr2 G T 6: 146,275,954 (GRCm39) H426Q probably damaging Het
Itpripl2 C T 7: 118,089,479 (GRCm39) G360D probably benign Het
Kif14 C T 1: 136,455,043 (GRCm39) R1572C probably damaging Het
L3mbtl3 A T 10: 26,178,583 (GRCm39) H568Q unknown Het
Lgi2 A G 5: 52,711,802 (GRCm39) Y173H probably damaging Het
Lpar5 A C 6: 125,058,954 (GRCm39) Y225S probably benign Het
Lpin3 A G 2: 160,745,894 (GRCm39) H675R probably damaging Het
Lrp2 C A 2: 69,278,464 (GRCm39) G3963V probably damaging Het
Man1a2 G T 3: 100,591,891 (GRCm39) D13E possibly damaging Het
Map1a T C 2: 121,138,495 (GRCm39) V2753A probably damaging Het
Mitf C A 6: 97,980,865 (GRCm39) N97K probably damaging Het
Msh2 A G 17: 87,980,238 (GRCm39) probably null Het
Msr1 T C 8: 40,073,041 (GRCm39) E170G probably damaging Het
Myrip C A 9: 120,217,302 (GRCm39) R79S probably damaging Het
Nek10 G A 14: 14,857,782 (GRCm38) probably null Het
Neto1 C T 18: 86,422,854 (GRCm39) R104* probably null Het
Nom1 A C 5: 29,656,098 (GRCm39) K821T probably damaging Het
Nrxn1 A G 17: 91,011,609 (GRCm39) V340A probably damaging Het
Nxpe4 A T 9: 48,307,897 (GRCm39) I334F probably benign Het
Or1e23 A G 11: 73,407,753 (GRCm39) S91P probably benign Het
Or2ag1 T C 7: 106,313,184 (GRCm39) K235E probably benign Het
Or4a74 T C 2: 89,439,718 (GRCm39) M243V probably benign Het
Or5al7 T A 2: 85,992,435 (GRCm39) N286I probably damaging Het
Or5b124 T C 19: 13,610,700 (GRCm39) V75A probably damaging Het
Or8k27 C T 2: 86,275,473 (GRCm39) M284I probably benign Het
Padi4 A G 4: 140,484,896 (GRCm39) S322P probably damaging Het
Peli3 A G 19: 4,991,810 (GRCm39) Y44H probably damaging Het
Prdm4 A G 10: 85,743,767 (GRCm39) S163P probably damaging Het
Prom2 T C 2: 127,381,445 (GRCm39) D227G probably benign Het
Ptgfr C T 3: 151,507,400 (GRCm39) R321H probably benign Het
Resf1 A T 6: 149,227,199 (GRCm39) I82L probably benign Het
Rgs3 G A 4: 62,544,143 (GRCm39) R136H probably damaging Het
Rgsl1 T G 1: 153,719,853 (GRCm39) N3T possibly damaging Het
Rif1 T C 2: 52,002,575 (GRCm39) S2010P probably benign Het
Rngtt T C 4: 33,368,690 (GRCm39) F408L probably damaging Het
Rtn3 T G 19: 7,434,958 (GRCm39) T326P probably benign Het
Slc18b1 A C 10: 23,681,936 (GRCm39) M167L probably benign Het
Slc22a26 A G 19: 7,765,575 (GRCm39) probably null Het
Slitrk6 T C 14: 110,989,317 (GRCm39) D130G probably damaging Het
Snap47 A G 11: 59,319,439 (GRCm39) V233A probably benign Het
Sumf1 A C 6: 108,121,632 (GRCm39) Y158D probably damaging Het
Tbc1d15 A T 10: 115,056,215 (GRCm39) H252Q probably benign Het
Tmem45a2 T C 16: 56,869,777 (GRCm39) I56V probably benign Het
Ttc21b A G 2: 66,066,577 (GRCm39) S359P probably benign Het
Ttc27 T C 17: 75,036,972 (GRCm39) I215T probably benign Het
Ttn C T 2: 76,554,539 (GRCm39) V30759I possibly damaging Het
Vdac3 T C 8: 23,070,404 (GRCm39) N168S probably damaging Het
Wdr7 T C 18: 63,998,371 (GRCm39) V1106A probably benign Het
Wrap73 T A 4: 154,226,948 (GRCm39) F16Y probably damaging Het
Zfat C A 15: 68,052,652 (GRCm39) D381Y probably damaging Het
Other mutations in Thsd7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thsd7b APN 1 129,523,571 (GRCm39) missense probably damaging 1.00
IGL00850:Thsd7b APN 1 130,092,814 (GRCm39) missense probably benign 0.00
IGL00987:Thsd7b APN 1 129,541,016 (GRCm39) missense probably damaging 1.00
IGL01068:Thsd7b APN 1 129,523,883 (GRCm39) missense probably damaging 1.00
IGL01091:Thsd7b APN 1 129,704,071 (GRCm39) missense probably benign 0.29
IGL01535:Thsd7b APN 1 129,605,954 (GRCm39) missense possibly damaging 0.64
IGL01560:Thsd7b APN 1 130,145,918 (GRCm39) utr 3 prime probably benign
IGL01701:Thsd7b APN 1 129,358,665 (GRCm39) missense probably benign 0.07
IGL01775:Thsd7b APN 1 129,556,676 (GRCm39) missense probably damaging 0.99
IGL02077:Thsd7b APN 1 129,744,419 (GRCm39) missense probably damaging 1.00
IGL02338:Thsd7b APN 1 129,523,508 (GRCm39) missense probably damaging 1.00
IGL02340:Thsd7b APN 1 130,087,369 (GRCm39) missense probably benign 0.01
IGL02404:Thsd7b APN 1 129,540,888 (GRCm39) missense probably damaging 1.00
IGL02519:Thsd7b APN 1 129,540,932 (GRCm39) missense probably benign 0.22
IGL02543:Thsd7b APN 1 130,092,840 (GRCm39) missense probably benign 0.03
IGL02740:Thsd7b APN 1 129,540,864 (GRCm39) missense probably damaging 0.99
IGL02793:Thsd7b APN 1 129,879,130 (GRCm39) missense probably damaging 1.00
IGL02875:Thsd7b APN 1 129,879,130 (GRCm39) missense probably damaging 1.00
IGL02986:Thsd7b APN 1 129,843,352 (GRCm39) missense probably benign 0.01
IGL03108:Thsd7b APN 1 130,138,013 (GRCm39) missense probably damaging 1.00
IGL03114:Thsd7b APN 1 130,116,288 (GRCm39) missense probably benign 0.00
IGL03195:Thsd7b APN 1 129,556,646 (GRCm39) missense probably damaging 1.00
IGL03291:Thsd7b APN 1 129,688,092 (GRCm39) missense possibly damaging 0.94
IGL03397:Thsd7b APN 1 129,523,901 (GRCm39) missense probably benign 0.17
IGL03399:Thsd7b APN 1 129,556,622 (GRCm39) missense probably damaging 1.00
R0184:Thsd7b UTSW 1 129,358,701 (GRCm39) missense probably benign 0.00
R0277:Thsd7b UTSW 1 130,123,000 (GRCm39) missense probably benign 0.00
R0526:Thsd7b UTSW 1 129,879,129 (GRCm39) missense probably damaging 1.00
R0746:Thsd7b UTSW 1 130,116,268 (GRCm39) missense probably benign 0.00
R0784:Thsd7b UTSW 1 129,523,096 (GRCm39) splice site probably benign
R1158:Thsd7b UTSW 1 130,117,672 (GRCm39) splice site probably null
R1267:Thsd7b UTSW 1 129,556,577 (GRCm39) splice site probably null
R1375:Thsd7b UTSW 1 130,087,423 (GRCm39) missense probably damaging 1.00
R1565:Thsd7b UTSW 1 129,523,778 (GRCm39) missense possibly damaging 0.94
R1728:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1728:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1728:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1728:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1729:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1729:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1729:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1729:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1730:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1730:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1730:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1730:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1739:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1739:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1739:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1739:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1762:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1762:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1762:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1762:Thsd7b UTSW 1 130,030,813 (GRCm39) missense possibly damaging 0.92
R1762:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1783:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1783:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1783:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1783:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1784:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1784:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1784:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1784:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1785:Thsd7b UTSW 1 129,605,920 (GRCm39) missense probably benign
R1785:Thsd7b UTSW 1 129,595,674 (GRCm39) missense probably benign 0.00
R1785:Thsd7b UTSW 1 129,556,628 (GRCm39) missense probably damaging 1.00
R1785:Thsd7b UTSW 1 130,044,368 (GRCm39) missense probably benign
R1812:Thsd7b UTSW 1 129,686,347 (GRCm39) missense probably damaging 1.00
R1846:Thsd7b UTSW 1 129,540,993 (GRCm39) missense probably damaging 1.00
R1908:Thsd7b UTSW 1 129,605,846 (GRCm39) missense probably damaging 0.99
R1996:Thsd7b UTSW 1 129,686,188 (GRCm39) nonsense probably null
R2199:Thsd7b UTSW 1 130,145,895 (GRCm39) missense probably benign 0.04
R2483:Thsd7b UTSW 1 130,030,809 (GRCm39) missense probably damaging 1.00
R2919:Thsd7b UTSW 1 130,117,587 (GRCm39) splice site probably benign
R2935:Thsd7b UTSW 1 129,605,824 (GRCm39) missense possibly damaging 0.83
R3113:Thsd7b UTSW 1 129,977,599 (GRCm39) missense probably benign 0.23
R3236:Thsd7b UTSW 1 130,145,855 (GRCm39) nonsense probably null
R3745:Thsd7b UTSW 1 129,605,978 (GRCm39) missense probably benign 0.04
R3877:Thsd7b UTSW 1 130,117,919 (GRCm39) missense possibly damaging 0.92
R3880:Thsd7b UTSW 1 129,523,107 (GRCm39) missense probably damaging 1.00
R4110:Thsd7b UTSW 1 130,044,356 (GRCm39) missense probably benign 0.18
R4112:Thsd7b UTSW 1 130,044,356 (GRCm39) missense probably benign 0.18
R4255:Thsd7b UTSW 1 129,688,024 (GRCm39) missense possibly damaging 0.79
R4621:Thsd7b UTSW 1 129,358,652 (GRCm39) missense possibly damaging 0.47
R4703:Thsd7b UTSW 1 129,977,646 (GRCm39) intron probably benign
R4732:Thsd7b UTSW 1 129,540,923 (GRCm39) missense probably damaging 1.00
R4733:Thsd7b UTSW 1 129,540,923 (GRCm39) missense probably damaging 1.00
R4755:Thsd7b UTSW 1 130,138,001 (GRCm39) missense probably benign 0.01
R4805:Thsd7b UTSW 1 130,116,276 (GRCm39) missense probably benign 0.04
R4840:Thsd7b UTSW 1 129,523,581 (GRCm39) missense probably benign 0.00
R4879:Thsd7b UTSW 1 130,116,236 (GRCm39) missense possibly damaging 0.62
R4936:Thsd7b UTSW 1 129,605,882 (GRCm39) missense probably benign 0.00
R4972:Thsd7b UTSW 1 130,116,309 (GRCm39) missense probably damaging 0.97
R5304:Thsd7b UTSW 1 129,605,980 (GRCm39) nonsense probably null
R5422:Thsd7b UTSW 1 129,849,071 (GRCm39) missense probably benign 0.41
R5495:Thsd7b UTSW 1 129,523,570 (GRCm39) missense probably damaging 1.00
R5598:Thsd7b UTSW 1 129,523,578 (GRCm39) missense probably damaging 1.00
R5620:Thsd7b UTSW 1 130,090,673 (GRCm39) critical splice donor site probably null
R5638:Thsd7b UTSW 1 129,523,270 (GRCm39) missense probably benign 0.00
R5640:Thsd7b UTSW 1 130,044,408 (GRCm39) nonsense probably null
R5655:Thsd7b UTSW 1 129,556,671 (GRCm39) splice site probably null
R5711:Thsd7b UTSW 1 129,688,139 (GRCm39) missense probably damaging 1.00
R5823:Thsd7b UTSW 1 129,605,821 (GRCm39) missense probably benign 0.00
R5888:Thsd7b UTSW 1 130,138,057 (GRCm39) nonsense probably null
R5932:Thsd7b UTSW 1 129,358,575 (GRCm39) missense probably benign
R6243:Thsd7b UTSW 1 130,090,599 (GRCm39) missense probably benign 0.21
R6258:Thsd7b UTSW 1 129,595,655 (GRCm39) missense probably benign
R6260:Thsd7b UTSW 1 129,595,655 (GRCm39) missense probably benign
R6399:Thsd7b UTSW 1 129,744,385 (GRCm39) missense probably benign 0.13
R6437:Thsd7b UTSW 1 129,744,419 (GRCm39) missense probably damaging 1.00
R6719:Thsd7b UTSW 1 130,087,451 (GRCm39) splice site probably null
R6785:Thsd7b UTSW 1 129,358,644 (GRCm39) missense probably damaging 0.99
R7304:Thsd7b UTSW 1 130,030,890 (GRCm39) missense probably benign 0.01
R7334:Thsd7b UTSW 1 130,123,012 (GRCm39) missense probably benign 0.00
R7414:Thsd7b UTSW 1 129,556,717 (GRCm39) missense probably damaging 0.99
R7673:Thsd7b UTSW 1 129,843,487 (GRCm39) splice site probably null
R7683:Thsd7b UTSW 1 129,523,683 (GRCm39) missense probably damaging 0.99
R7861:Thsd7b UTSW 1 130,087,435 (GRCm39) missense probably benign 0.00
R8145:Thsd7b UTSW 1 129,688,036 (GRCm39) missense probably damaging 1.00
R8241:Thsd7b UTSW 1 130,117,688 (GRCm39) missense probably damaging 1.00
R8296:Thsd7b UTSW 1 129,523,193 (GRCm39) missense probably benign 0.01
R8355:Thsd7b UTSW 1 129,523,616 (GRCm39) missense probably damaging 1.00
R8507:Thsd7b UTSW 1 129,605,790 (GRCm39) missense probably benign 0.21
R8520:Thsd7b UTSW 1 129,849,157 (GRCm39) missense probably benign 0.07
R8555:Thsd7b UTSW 1 129,523,191 (GRCm39) missense probably damaging 1.00
R8682:Thsd7b UTSW 1 129,688,011 (GRCm39) nonsense probably null
R8981:Thsd7b UTSW 1 129,523,187 (GRCm39) missense possibly damaging 0.88
R9029:Thsd7b UTSW 1 130,087,426 (GRCm39) missense probably damaging 1.00
R9133:Thsd7b UTSW 1 129,843,382 (GRCm39) missense probably benign 0.18
R9194:Thsd7b UTSW 1 129,843,371 (GRCm39) missense possibly damaging 0.78
R9229:Thsd7b UTSW 1 129,849,027 (GRCm39) missense probably damaging 1.00
R9239:Thsd7b UTSW 1 130,087,453 (GRCm39) critical splice donor site probably null
R9460:Thsd7b UTSW 1 130,090,674 (GRCm39) critical splice donor site probably null
R9466:Thsd7b UTSW 1 130,122,866 (GRCm39) missense probably benign
R9588:Thsd7b UTSW 1 130,108,223 (GRCm39) missense probably damaging 1.00
X0027:Thsd7b UTSW 1 129,523,809 (GRCm39) missense probably benign 0.00
Z1176:Thsd7b UTSW 1 129,556,648 (GRCm39) missense probably benign 0.17
Z1176:Thsd7b UTSW 1 129,523,397 (GRCm39) missense probably benign 0.01
Z1176:Thsd7b UTSW 1 129,523,253 (GRCm39) missense probably damaging 0.98
Z1176:Thsd7b UTSW 1 130,108,161 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCAACCCCTGAAACTCAGTGATGC -3'
(R):5'- TCATCAGTCTCCAGATCCCATCAGC -3'

Sequencing Primer
(F):5'- CCTGAAACTCAGTGATGCTTTGTG -3'
(R):5'- CCAGCTtttctttctttctttctttc -3'
Posted On 2013-07-11