Mutagenetix > Incidental Mutation

Incidental Mutation 'R0633:Thsd7b'

58033

Institutional Source

Beutler Lab

Gene Symbol

Thsd7b

Ensembl Gene

ENSMUSG00000042581

Gene Name

thrombospondin, type I, domain containing 7B

Synonyms

1700074E13Rik, D130067I03Rik

MMRRC Submission

038822-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.172) question?

Stock #

R0633 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

129273302-130219278 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 130188526 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1339 (S1339P)

Ref Sequence

ENSEMBL: ENSMUSP00000073220 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073527]

AlphaFold

Q6P4U0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000073527
AA Change: S1339P

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: S1339P

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
Blast:TSP1	43	98	5e-29	BLAST
Blast:TSP1	122	177	9e-24	BLAST
TSP1	182	233	2.47e-9	SMART
TSP1	339	399	7e-9	SMART
Blast:TSP1	402	482	2e-27	BLAST
TSP1	487	543	2.12e-1	SMART
TSP1	604	661	3.9e-7	SMART
TSP1	664	735	2.73e-2	SMART
TSP1	740	796	1.01e-5	SMART
Blast:TSP1	799	869	6e-35	BLAST
TSP1	874	922	9.68e-3	SMART
TSP1	952	999	2.42e0	SMART
TSP1	1004	1059	3.96e-8	SMART
TSP1	1062	1126	1.73e0	SMART
TSP1	1131	1182	6.05e-4	SMART
TSP1	1185	1246	9.52e-1	SMART
TSP1	1251	1303	3.21e-8	SMART
TSP1	1304	1369	5.52e-1	SMART
TSP1	1374	1432	3.92e-2	SMART
transmembrane domain	1558	1580	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140834

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.4%
20x: 94.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	T	6: 149,325,701	I82L	probably benign	Het
4921530L21Rik	T	G	14: 95,881,943	N45K	probably damaging	Het
4933408B17Rik	A	G	18: 34,586,266	V167A	possibly damaging	Het
Adamts8	A	T	9: 30,943,511	R18S	probably damaging	Het
Adgb	G	A	10: 10,391,729	A923V	probably benign	Het
Aldh1a3	A	G	7: 66,400,222	V416A	probably damaging	Het
Alox5	C	T	6: 116,420,384	G280R	probably damaging	Het
Anapc5	A	T	5: 122,800,632	Y360N	probably damaging	Het
Apbb1	C	T	7: 105,558,963	V685I	probably damaging	Het
Apc2	C	A	10: 80,307,455	A463E	probably damaging	Het
Arhgap21	C	T	2: 20,855,387	W1170*	probably null	Het
Atat1	G	A	17: 35,901,423	R305C	probably damaging	Het
Cars2	T	C	8: 11,550,511	D56G	probably benign	Het
Cdc42bpb	T	C	12: 111,345,555	I108V	probably damaging	Het
Cftr	T	A	6: 18,305,980	I1255K	probably damaging	Het
Ckap5	T	C	2: 91,550,743	L148P	probably damaging	Het
Cntn4	A	G	6: 106,679,248		probably null	Het
Cpe	G	A	8: 64,609,203	P273L	probably damaging	Het
Cpsf7	A	G	19: 10,531,782	D19G	probably benign	Het
Ddx25	C	A	9: 35,545,972	R349L	probably damaging	Het
Depdc7	T	C	2: 104,722,881	D446G	probably benign	Het
Det1	T	A	7: 78,843,935	N107I	probably benign	Het
Dock6	A	T	9: 21,844,417	D170E	probably benign	Het
Dvl1	C	T	4: 155,858,295	L673F	probably damaging	Het
Gucy1b1	A	T	3: 82,045,460	I222K	probably benign	Het
Hfm1	T	C	5: 106,917,601	T71A	possibly damaging	Het
Ikzf1	A	G	11: 11,769,223	E310G	probably damaging	Het
Impg1	T	C	9: 80,394,155	E163G	possibly damaging	Het
Itpr2	G	T	6: 146,374,456	H426Q	probably damaging	Het
Itpripl2	C	T	7: 118,490,256	G360D	probably benign	Het
Kif14	C	T	1: 136,527,305	R1572C	probably damaging	Het
L3mbtl3	A	T	10: 26,302,685	H568Q	unknown	Het
Lgi2	A	G	5: 52,554,460	Y173H	probably damaging	Het
Lpar5	A	C	6: 125,081,991	Y225S	probably benign	Het
Lpin3	A	G	2: 160,903,974	H675R	probably damaging	Het
Lrp2	C	A	2: 69,448,120	G3963V	probably damaging	Het
Man1a2	G	T	3: 100,684,575	D13E	possibly damaging	Het
Map1a	T	C	2: 121,308,014	V2753A	probably damaging	Het
Mitf	C	A	6: 98,003,904	N97K	probably damaging	Het
Msh2	A	G	17: 87,672,810		probably null	Het
Msr1	T	C	8: 39,620,000	E170G	probably damaging	Het
Myrip	C	A	9: 120,388,236	R79S	probably damaging	Het
Nek10	G	A	14: 14,857,782		probably null	Het
Neto1	C	T	18: 86,404,729	R104*	probably null	Het
Nom1	A	C	5: 29,451,100	K821T	probably damaging	Het
Nrxn1	A	G	17: 90,704,181	V340A	probably damaging	Het
Nxpe4	A	T	9: 48,396,597	I334F	probably benign	Het
Olfr1043	T	A	2: 86,162,091	N286I	probably damaging	Het
Olfr1065	C	T	2: 86,445,129	M284I	probably benign	Het
Olfr1247	T	C	2: 89,609,374	M243V	probably benign	Het
Olfr1489	T	C	19: 13,633,336	V75A	probably damaging	Het
Olfr382	A	G	11: 73,516,927	S91P	probably benign	Het
Olfr705	T	C	7: 106,713,977	K235E	probably benign	Het
Padi4	A	G	4: 140,757,585	S322P	probably damaging	Het
Peli3	A	G	19: 4,941,782	Y44H	probably damaging	Het
Prdm4	A	G	10: 85,907,903	S163P	probably damaging	Het
Prom2	T	C	2: 127,539,525	D227G	probably benign	Het
Ptgfr	C	T	3: 151,801,763	R321H	probably benign	Het
Rgs3	G	A	4: 62,625,906	R136H	probably damaging	Het
Rgsl1	T	G	1: 153,844,107	N3T	possibly damaging	Het
Rif1	T	C	2: 52,112,563	S2010P	probably benign	Het
Rngtt	T	C	4: 33,368,690	F408L	probably damaging	Het
Rtn3	T	G	19: 7,457,593	T326P	probably benign	Het
Slc18b1	A	C	10: 23,806,038	M167L	probably benign	Het
Slc22a26	A	G	19: 7,788,210		probably null	Het
Slitrk6	T	C	14: 110,751,885	D130G	probably damaging	Het
Snap47	A	G	11: 59,428,613	V233A	probably benign	Het
Sumf1	A	C	6: 108,144,671	Y158D	probably damaging	Het
Tbc1d15	A	T	10: 115,220,310	H252Q	probably benign	Het
Tmem45a2	T	C	16: 57,049,414	I56V	probably benign	Het
Ttc21b	A	G	2: 66,236,233	S359P	probably benign	Het
Ttc27	T	C	17: 74,729,977	I215T	probably benign	Het
Ttn	C	T	2: 76,724,195	V30759I	possibly damaging	Het
Vdac3	T	C	8: 22,580,388	N168S	probably damaging	Het
Wdr7	T	C	18: 63,865,300	V1106A	probably benign	Het
Wrap73	T	A	4: 154,142,491	F16Y	probably damaging	Het
Zfat	C	A	15: 68,180,803	D381Y	probably damaging	Het

Other mutations in Thsd7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Thsd7b	APN	1	129595834	missense	probably damaging	1.00
IGL00850:Thsd7b	APN	1	130165077	missense	probably benign	0.00
IGL00987:Thsd7b	APN	1	129613279	missense	probably damaging	1.00
IGL01068:Thsd7b	APN	1	129596146	missense	probably damaging	1.00
IGL01091:Thsd7b	APN	1	129776334	missense	probably benign	0.29
IGL01535:Thsd7b	APN	1	129678217	missense	possibly damaging	0.64
IGL01560:Thsd7b	APN	1	130218181	utr 3 prime	probably benign
IGL01701:Thsd7b	APN	1	129430928	missense	probably benign	0.07
IGL01775:Thsd7b	APN	1	129628939	missense	probably damaging	0.99
IGL02077:Thsd7b	APN	1	129816682	missense	probably damaging	1.00
IGL02338:Thsd7b	APN	1	129595771	missense	probably damaging	1.00
IGL02340:Thsd7b	APN	1	130159632	missense	probably benign	0.01
IGL02404:Thsd7b	APN	1	129613151	missense	probably damaging	1.00
IGL02519:Thsd7b	APN	1	129613195	missense	probably benign	0.22
IGL02543:Thsd7b	APN	1	130165103	missense	probably benign	0.03
IGL02740:Thsd7b	APN	1	129613127	missense	probably damaging	0.99
IGL02793:Thsd7b	APN	1	129951393	missense	probably damaging	1.00
IGL02875:Thsd7b	APN	1	129951393	missense	probably damaging	1.00
IGL02986:Thsd7b	APN	1	129915615	missense	probably benign	0.01
IGL03108:Thsd7b	APN	1	130210276	missense	probably damaging	1.00
IGL03114:Thsd7b	APN	1	130188551	missense	probably benign	0.00
IGL03195:Thsd7b	APN	1	129628909	missense	probably damaging	1.00
IGL03291:Thsd7b	APN	1	129760355	missense	possibly damaging	0.94
IGL03397:Thsd7b	APN	1	129596164	missense	probably benign	0.17
IGL03399:Thsd7b	APN	1	129628885	missense	probably damaging	1.00
R0184:Thsd7b	UTSW	1	129430964	missense	probably benign	0.00
R0277:Thsd7b	UTSW	1	130195263	missense	probably benign	0.00
R0526:Thsd7b	UTSW	1	129951392	missense	probably damaging	1.00
R0746:Thsd7b	UTSW	1	130188531	missense	probably benign	0.00
R0784:Thsd7b	UTSW	1	129595359	splice site	probably benign
R1158:Thsd7b	UTSW	1	130189935	splice site	probably null
R1267:Thsd7b	UTSW	1	129628840	splice site	probably null
R1375:Thsd7b	UTSW	1	130159686	missense	probably damaging	1.00
R1565:Thsd7b	UTSW	1	129596041	missense	possibly damaging	0.94
R1728:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1728:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1728:Thsd7b	UTSW	1	129678183	missense	probably benign
R1728:Thsd7b	UTSW	1	130116631	missense	probably benign
R1729:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1729:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1729:Thsd7b	UTSW	1	129678183	missense	probably benign
R1729:Thsd7b	UTSW	1	130116631	missense	probably benign
R1730:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1730:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1730:Thsd7b	UTSW	1	129678183	missense	probably benign
R1730:Thsd7b	UTSW	1	130116631	missense	probably benign
R1739:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1739:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1739:Thsd7b	UTSW	1	129678183	missense	probably benign
R1739:Thsd7b	UTSW	1	130116631	missense	probably benign
R1762:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1762:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1762:Thsd7b	UTSW	1	129678183	missense	probably benign
R1762:Thsd7b	UTSW	1	130103076	missense	possibly damaging	0.92
R1762:Thsd7b	UTSW	1	130116631	missense	probably benign
R1783:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1783:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1783:Thsd7b	UTSW	1	129678183	missense	probably benign
R1783:Thsd7b	UTSW	1	130116631	missense	probably benign
R1784:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1784:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1784:Thsd7b	UTSW	1	129678183	missense	probably benign
R1784:Thsd7b	UTSW	1	130116631	missense	probably benign
R1785:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1785:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1785:Thsd7b	UTSW	1	129678183	missense	probably benign
R1785:Thsd7b	UTSW	1	130116631	missense	probably benign
R1812:Thsd7b	UTSW	1	129758610	missense	probably damaging	1.00
R1846:Thsd7b	UTSW	1	129613256	missense	probably damaging	1.00
R1908:Thsd7b	UTSW	1	129678109	missense	probably damaging	0.99
R1996:Thsd7b	UTSW	1	129758451	nonsense	probably null
R2199:Thsd7b	UTSW	1	130218158	missense	probably benign	0.04
R2483:Thsd7b	UTSW	1	130103072	missense	probably damaging	1.00
R2919:Thsd7b	UTSW	1	130189850	splice site	probably benign
R2935:Thsd7b	UTSW	1	129678087	missense	possibly damaging	0.83
R3113:Thsd7b	UTSW	1	130049862	missense	probably benign	0.23
R3236:Thsd7b	UTSW	1	130218118	nonsense	probably null
R3745:Thsd7b	UTSW	1	129678241	missense	probably benign	0.04
R3877:Thsd7b	UTSW	1	130190182	missense	possibly damaging	0.92
R3880:Thsd7b	UTSW	1	129595370	missense	probably damaging	1.00
R4110:Thsd7b	UTSW	1	130116619	missense	probably benign	0.18
R4112:Thsd7b	UTSW	1	130116619	missense	probably benign	0.18
R4255:Thsd7b	UTSW	1	129760287	missense	possibly damaging	0.79
R4621:Thsd7b	UTSW	1	129430915	missense	possibly damaging	0.47
R4703:Thsd7b	UTSW	1	130049909	intron	probably benign
R4732:Thsd7b	UTSW	1	129613186	missense	probably damaging	1.00
R4733:Thsd7b	UTSW	1	129613186	missense	probably damaging	1.00
R4755:Thsd7b	UTSW	1	130210264	missense	probably benign	0.01
R4805:Thsd7b	UTSW	1	130188539	missense	probably benign	0.04
R4840:Thsd7b	UTSW	1	129595844	missense	probably benign	0.00
R4879:Thsd7b	UTSW	1	130188499	missense	possibly damaging	0.62
R4936:Thsd7b	UTSW	1	129678145	missense	probably benign	0.00
R4972:Thsd7b	UTSW	1	130188572	missense	probably damaging	0.97
R5304:Thsd7b	UTSW	1	129678243	nonsense	probably null
R5422:Thsd7b	UTSW	1	129921334	missense	probably benign	0.41
R5495:Thsd7b	UTSW	1	129595833	missense	probably damaging	1.00
R5598:Thsd7b	UTSW	1	129595841	missense	probably damaging	1.00
R5620:Thsd7b	UTSW	1	130162936	critical splice donor site	probably null
R5638:Thsd7b	UTSW	1	129595533	missense	probably benign	0.00
R5640:Thsd7b	UTSW	1	130116671	nonsense	probably null
R5655:Thsd7b	UTSW	1	129628934	splice site	probably null
R5711:Thsd7b	UTSW	1	129760402	missense	probably damaging	1.00
R5823:Thsd7b	UTSW	1	129678084	missense	probably benign	0.00
R5888:Thsd7b	UTSW	1	130210320	nonsense	probably null
R5932:Thsd7b	UTSW	1	129430838	missense	probably benign
R6243:Thsd7b	UTSW	1	130162862	missense	probably benign	0.21
R6258:Thsd7b	UTSW	1	129667918	missense	probably benign
R6260:Thsd7b	UTSW	1	129667918	missense	probably benign
R6399:Thsd7b	UTSW	1	129816648	missense	probably benign	0.13
R6437:Thsd7b	UTSW	1	129816682	missense	probably damaging	1.00
R6719:Thsd7b	UTSW	1	130159714	splice site	probably null
R6785:Thsd7b	UTSW	1	129430907	missense	probably damaging	0.99
R7304:Thsd7b	UTSW	1	130103153	missense	probably benign	0.01
R7334:Thsd7b	UTSW	1	130195275	missense	probably benign	0.00
R7414:Thsd7b	UTSW	1	129628980	missense	probably damaging	0.99
R7673:Thsd7b	UTSW	1	129915750	splice site	probably null
R7683:Thsd7b	UTSW	1	129595946	missense	probably damaging	0.99
R7861:Thsd7b	UTSW	1	130159698	missense	probably benign	0.00
R8145:Thsd7b	UTSW	1	129760299	missense	probably damaging	1.00
R8241:Thsd7b	UTSW	1	130189951	missense	probably damaging	1.00
R8296:Thsd7b	UTSW	1	129595456	missense	probably benign	0.01
R8355:Thsd7b	UTSW	1	129595879	missense	probably damaging	1.00
R8507:Thsd7b	UTSW	1	129678053	missense	probably benign	0.21
R8520:Thsd7b	UTSW	1	129921420	missense	probably benign	0.07
R8555:Thsd7b	UTSW	1	129595454	missense	probably damaging	1.00
R8682:Thsd7b	UTSW	1	129760274	nonsense	probably null
R8981:Thsd7b	UTSW	1	129595450	missense	possibly damaging	0.88
R9029:Thsd7b	UTSW	1	130159689	missense	probably damaging	1.00
R9133:Thsd7b	UTSW	1	129915645	missense	probably benign	0.18
R9194:Thsd7b	UTSW	1	129915634	missense	possibly damaging	0.78
R9229:Thsd7b	UTSW	1	129921290	missense	probably damaging	1.00
R9239:Thsd7b	UTSW	1	130159716	critical splice donor site	probably null
R9460:Thsd7b	UTSW	1	130162937	critical splice donor site	probably null
R9466:Thsd7b	UTSW	1	130195129	missense	probably benign
R9588:Thsd7b	UTSW	1	130180486	missense	probably damaging	1.00
X0027:Thsd7b	UTSW	1	129596072	missense	probably benign	0.00
Z1176:Thsd7b	UTSW	1	129595516	missense	probably damaging	0.98
Z1176:Thsd7b	UTSW	1	129595660	missense	probably benign	0.01
Z1176:Thsd7b	UTSW	1	129628911	missense	probably benign	0.17
Z1176:Thsd7b	UTSW	1	130180424	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- TCAACCCCTGAAACTCAGTGATGC -3'
(R):5'- TCATCAGTCTCCAGATCCCATCAGC -3'

Sequencing Primer
(F):5'- CCTGAAACTCAGTGATGCTTTGTG -3'
(R):5'- CCAGCTtttctttctttctttctttc -3'

Posted On

2013-07-11