Mutagenetix > Incidental Mutation

Incidental Mutation 'R0633:Rgsl1'

58035

Institutional Source

Beutler Lab

Gene Symbol

Rgsl1

Ensembl Gene

ENSMUSG00000042641

Gene Name

regulator of G-protein signaling like 1

Synonyms

Rgsl2, 4930415K13Rik

MMRRC Submission

038822-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0633 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

153779381-153844142 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 153844107 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 3 (N3T)

Ref Sequence

ENSEMBL: ENSMUSP00000135642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000185164]

AlphaFold

A0A5F8MPV0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124558
AA Change: N3T

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: N3T

Domain	Start	End	E-Value	Type
low complexity region	122	136	N/A	INTRINSIC
low complexity region	242	254	N/A	INTRINSIC
low complexity region	316	325	N/A	INTRINSIC
Pfam:RGS	644	754	7.1e-12	PFAM
transmembrane domain	956	973	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185164
AA Change: N3T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641
AA Change: N3T

Domain	Start	End	E-Value	Type
low complexity region	157	171	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	351	360	N/A	INTRINSIC
Pfam:RGS	679	789	4.1e-11	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.4%
20x: 94.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	T	6: 149,325,701	I82L	probably benign	Het
4921530L21Rik	T	G	14: 95,881,943	N45K	probably damaging	Het
4933408B17Rik	A	G	18: 34,586,266	V167A	possibly damaging	Het
Adamts8	A	T	9: 30,943,511	R18S	probably damaging	Het
Adgb	G	A	10: 10,391,729	A923V	probably benign	Het
Aldh1a3	A	G	7: 66,400,222	V416A	probably damaging	Het
Alox5	C	T	6: 116,420,384	G280R	probably damaging	Het
Anapc5	A	T	5: 122,800,632	Y360N	probably damaging	Het
Apbb1	C	T	7: 105,558,963	V685I	probably damaging	Het
Apc2	C	A	10: 80,307,455	A463E	probably damaging	Het
Arhgap21	C	T	2: 20,855,387	W1170*	probably null	Het
Atat1	G	A	17: 35,901,423	R305C	probably damaging	Het
Cars2	T	C	8: 11,550,511	D56G	probably benign	Het
Cdc42bpb	T	C	12: 111,345,555	I108V	probably damaging	Het
Cftr	T	A	6: 18,305,980	I1255K	probably damaging	Het
Ckap5	T	C	2: 91,550,743	L148P	probably damaging	Het
Cntn4	A	G	6: 106,679,248		probably null	Het
Cpe	G	A	8: 64,609,203	P273L	probably damaging	Het
Cpsf7	A	G	19: 10,531,782	D19G	probably benign	Het
Ddx25	C	A	9: 35,545,972	R349L	probably damaging	Het
Depdc7	T	C	2: 104,722,881	D446G	probably benign	Het
Det1	T	A	7: 78,843,935	N107I	probably benign	Het
Dock6	A	T	9: 21,844,417	D170E	probably benign	Het
Dvl1	C	T	4: 155,858,295	L673F	probably damaging	Het
Gucy1b1	A	T	3: 82,045,460	I222K	probably benign	Het
Hfm1	T	C	5: 106,917,601	T71A	possibly damaging	Het
Ikzf1	A	G	11: 11,769,223	E310G	probably damaging	Het
Impg1	T	C	9: 80,394,155	E163G	possibly damaging	Het
Itpr2	G	T	6: 146,374,456	H426Q	probably damaging	Het
Itpripl2	C	T	7: 118,490,256	G360D	probably benign	Het
Kif14	C	T	1: 136,527,305	R1572C	probably damaging	Het
L3mbtl3	A	T	10: 26,302,685	H568Q	unknown	Het
Lgi2	A	G	5: 52,554,460	Y173H	probably damaging	Het
Lpar5	A	C	6: 125,081,991	Y225S	probably benign	Het
Lpin3	A	G	2: 160,903,974	H675R	probably damaging	Het
Lrp2	C	A	2: 69,448,120	G3963V	probably damaging	Het
Man1a2	G	T	3: 100,684,575	D13E	possibly damaging	Het
Map1a	T	C	2: 121,308,014	V2753A	probably damaging	Het
Mitf	C	A	6: 98,003,904	N97K	probably damaging	Het
Msh2	A	G	17: 87,672,810		probably null	Het
Msr1	T	C	8: 39,620,000	E170G	probably damaging	Het
Myrip	C	A	9: 120,388,236	R79S	probably damaging	Het
Nek10	G	A	14: 14,857,782		probably null	Het
Neto1	C	T	18: 86,404,729	R104*	probably null	Het
Nom1	A	C	5: 29,451,100	K821T	probably damaging	Het
Nrxn1	A	G	17: 90,704,181	V340A	probably damaging	Het
Nxpe4	A	T	9: 48,396,597	I334F	probably benign	Het
Olfr1043	T	A	2: 86,162,091	N286I	probably damaging	Het
Olfr1065	C	T	2: 86,445,129	M284I	probably benign	Het
Olfr1247	T	C	2: 89,609,374	M243V	probably benign	Het
Olfr1489	T	C	19: 13,633,336	V75A	probably damaging	Het
Olfr382	A	G	11: 73,516,927	S91P	probably benign	Het
Olfr705	T	C	7: 106,713,977	K235E	probably benign	Het
Padi4	A	G	4: 140,757,585	S322P	probably damaging	Het
Peli3	A	G	19: 4,941,782	Y44H	probably damaging	Het
Prdm4	A	G	10: 85,907,903	S163P	probably damaging	Het
Prom2	T	C	2: 127,539,525	D227G	probably benign	Het
Ptgfr	C	T	3: 151,801,763	R321H	probably benign	Het
Rgs3	G	A	4: 62,625,906	R136H	probably damaging	Het
Rif1	T	C	2: 52,112,563	S2010P	probably benign	Het
Rngtt	T	C	4: 33,368,690	F408L	probably damaging	Het
Rtn3	T	G	19: 7,457,593	T326P	probably benign	Het
Slc18b1	A	C	10: 23,806,038	M167L	probably benign	Het
Slc22a26	A	G	19: 7,788,210		probably null	Het
Slitrk6	T	C	14: 110,751,885	D130G	probably damaging	Het
Snap47	A	G	11: 59,428,613	V233A	probably benign	Het
Sumf1	A	C	6: 108,144,671	Y158D	probably damaging	Het
Tbc1d15	A	T	10: 115,220,310	H252Q	probably benign	Het
Thsd7b	T	C	1: 130,188,526	S1339P	possibly damaging	Het
Tmem45a2	T	C	16: 57,049,414	I56V	probably benign	Het
Ttc21b	A	G	2: 66,236,233	S359P	probably benign	Het
Ttc27	T	C	17: 74,729,977	I215T	probably benign	Het
Ttn	C	T	2: 76,724,195	V30759I	possibly damaging	Het
Vdac3	T	C	8: 22,580,388	N168S	probably damaging	Het
Wdr7	T	C	18: 63,865,300	V1106A	probably benign	Het
Wrap73	T	A	4: 154,142,491	F16Y	probably damaging	Het
Zfat	C	A	15: 68,180,803	D381Y	probably damaging	Het

Other mutations in Rgsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01372:Rgsl1	APN	1	153826141	missense	probably damaging	1.00
IGL02253:Rgsl1	APN	1	153793767	missense	probably damaging	1.00
IGL02345:Rgsl1	APN	1	153804009	splice site	probably null
IGL02409:Rgsl1	APN	1	153826243	missense	possibly damaging	0.53
IGL02587:Rgsl1	APN	1	153799938	missense	probably damaging	1.00
IGL02652:Rgsl1	APN	1	153825490	missense	probably damaging	1.00
IGL02797:Rgsl1	APN	1	153807708	missense	probably damaging	1.00
IGL03032:Rgsl1	APN	1	153826202	missense	possibly damaging	0.53
IGL03082:Rgsl1	APN	1	153799947	missense	possibly damaging	0.86
IGL03123:Rgsl1	APN	1	153825941	missense	probably damaging	1.00
IGL03213:Rgsl1	APN	1	153825841	missense	probably benign	0.12
IGL03410:Rgsl1	APN	1	153793755	missense	probably null	0.82
Bam	UTSW	1	153794152	missense	probably benign	0.00
Candygram	UTSW	1	153821499	nonsense	probably null
wham	UTSW	1	153802292	missense	probably benign	0.02
IGL03050:Rgsl1	UTSW	1	153825676	missense	possibly damaging	0.60
PIT4519001:Rgsl1	UTSW	1	153825970	missense	possibly damaging	0.96
R0149:Rgsl1	UTSW	1	153793764	missense	probably damaging	1.00
R0536:Rgsl1	UTSW	1	153826181	missense	probably damaging	1.00
R0726:Rgsl1	UTSW	1	153802328	missense	probably damaging	1.00
R0839:Rgsl1	UTSW	1	153802234	critical splice donor site	probably null
R1240:Rgsl1	UTSW	1	153785191	missense	probably benign	0.18
R1355:Rgsl1	UTSW	1	153807761	start codon destroyed	probably null	0.23
R1491:Rgsl1	UTSW	1	153825926	missense	possibly damaging	0.93
R1688:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1694:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1842:Rgsl1	UTSW	1	153799797	missense	probably damaging	1.00
R2008:Rgsl1	UTSW	1	153825905	missense	possibly damaging	0.53
R2114:Rgsl1	UTSW	1	153817549	missense	probably benign
R2116:Rgsl1	UTSW	1	153817549	missense	probably benign
R2176:Rgsl1	UTSW	1	153825268	splice site	probably benign
R2229:Rgsl1	UTSW	1	153822358	missense	possibly damaging	0.72
R2895:Rgsl1	UTSW	1	153827548	missense	probably damaging	1.00
R3923:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R4001:Rgsl1	UTSW	1	153817584	missense	probably damaging	1.00
R4434:Rgsl1	UTSW	1	153802341	missense	possibly damaging	0.52
R4489:Rgsl1	UTSW	1	153827536	missense	probably benign	0.27
R4649:Rgsl1	UTSW	1	153817582	missense	probably benign	0.01
R4925:Rgsl1	UTSW	1	153812277	missense	probably benign	0.01
R4928:Rgsl1	UTSW	1	153793768	missense	probably damaging	1.00
R5045:Rgsl1	UTSW	1	153821522	nonsense	probably null
R5304:Rgsl1	UTSW	1	153827492	missense	probably damaging	0.97
R5331:Rgsl1	UTSW	1	153802292	missense	probably benign	0.02
R5373:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5374:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5566:Rgsl1	UTSW	1	153793774	missense	probably damaging	1.00
R5649:Rgsl1	UTSW	1	153825893	missense	possibly damaging	0.93
R6062:Rgsl1	UTSW	1	153799872	missense	possibly damaging	0.72
R6142:Rgsl1	UTSW	1	153812238	missense	probably benign	0.01
R6158:Rgsl1	UTSW	1	153804021	missense	possibly damaging	0.72
R6184:Rgsl1	UTSW	1	153827448	missense	probably benign	0.08
R6273:Rgsl1	UTSW	1	153827465	missense	possibly damaging	0.96
R6384:Rgsl1	UTSW	1	153827545	missense	possibly damaging	0.86
R6419:Rgsl1	UTSW	1	153822371	missense	probably damaging	0.98
R6568:Rgsl1	UTSW	1	153821546	missense	possibly damaging	0.72
R6660:Rgsl1	UTSW	1	153825766	missense	possibly damaging	0.70
R6745:Rgsl1	UTSW	1	153822317	missense	probably benign	0.18
R6892:Rgsl1	UTSW	1	153821499	nonsense	probably null
R6974:Rgsl1	UTSW	1	153799822	missense	probably damaging	1.00
R7172:Rgsl1	UTSW	1	153826220	missense	possibly damaging	0.72
R7200:Rgsl1	UTSW	1	153785199	missense	probably benign	0.33
R7275:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R7313:Rgsl1	UTSW	1	153807876	critical splice acceptor site	probably null
R7341:Rgsl1	UTSW	1	153793845	missense	probably benign	0.01
R7448:Rgsl1	UTSW	1	153844101	critical splice donor site	probably null
R7662:Rgsl1	UTSW	1	153825479	missense	probably benign
R7703:Rgsl1	UTSW	1	153793864	missense	possibly damaging	0.73
R7846:Rgsl1	UTSW	1	153826037	missense	possibly damaging	0.53
R8408:Rgsl1	UTSW	1	153825689	missense	possibly damaging	0.96
R8860:Rgsl1	UTSW	1	153821354	nonsense	probably null
R8894:Rgsl1	UTSW	1	153822373	critical splice acceptor site	probably null
R9043:Rgsl1	UTSW	1	153841821	missense	possibly damaging	0.73
R9187:Rgsl1	UTSW	1	153793867	missense	possibly damaging	0.53
R9280:Rgsl1	UTSW	1	153794152	missense	probably benign	0.00
R9326:Rgsl1	UTSW	1	153804022	missense	probably benign	0.01
R9388:Rgsl1	UTSW	1	153817609	missense	probably benign
R9479:Rgsl1	UTSW	1	153781699	missense	unknown
X0020:Rgsl1	UTSW	1	153825385	missense	probably benign	0.33
X0065:Rgsl1	UTSW	1	153804033	missense	possibly damaging	0.84
Z1177:Rgsl1	UTSW	1	153817610	missense	possibly damaging	0.70
Z1177:Rgsl1	UTSW	1	153825988	missense	not run

Predicted Primers

PCR Primer
(F):5'- TGACTGATACCAGGCCATGTTTGTC -3'
(R):5'- GCCAAGTTCAGTGATGTGACTCCTC -3'

Sequencing Primer
(F):5'- CAGGCCATGTTTGTCTTTGAATAAC -3'
(R):5'- CTTAGACAGACTTGGGAAGACATTTC -3'

Posted On

2013-07-11