Incidental Mutation 'R7488:Kdm3b'
ID580377
Institutional Source Beutler Lab
Gene Symbol Kdm3b
Ensembl Gene ENSMUSG00000038773
Gene NameKDM3B lysine (K)-specific demethylase 3B
SynonymsJHDM2B, Jmjd1b, 5830462I21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R7488 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location34777047-34838660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34824881 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1300 (S1300P)
Ref Sequence ENSEMBL: ENSMUSP00000037628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043775] [ENSMUST00000225195]
Predicted Effect probably damaging
Transcript: ENSMUST00000043775
AA Change: S1300P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037628
Gene: ENSMUSG00000038773
AA Change: S1300P

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Blast:JmjC 149 944 N/A BLAST
Blast:JmjC 946 1064 5e-40 BLAST
Blast:JmjC 1069 1471 N/A BLAST
JmjC 1499 1722 2.43e-65 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000225195
AA Change: S1100P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A G 8: 45,962,294 V225A probably benign Het
1810046K07Rik C A 9: 51,290,060 R232L probably damaging Het
2700049A03Rik T A 12: 71,150,405 F251I possibly damaging Het
4931408C20Rik T C 1: 26,683,958 T714A possibly damaging Het
Abcb11 C T 2: 69,277,802 G717D probably benign Het
Abcc1 G A 16: 14,389,899 W47* probably null Het
Ahnak2 A G 12: 112,785,021 I402T Het
Ankfy1 G A 11: 72,759,943 R984Q probably benign Het
Apaf1 A G 10: 91,054,380 I598T probably benign Het
Apobec1 G T 6: 122,581,562 P78Q possibly damaging Het
Asap1 A T 15: 64,120,125 I737N probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Bcr A C 10: 75,160,330 D902A possibly damaging Het
Bicra T C 7: 15,989,442 probably null Het
Ccdc27 T C 4: 154,032,967 T508A probably benign Het
Ccz1 T A 5: 143,991,583 N383I probably damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Cdhr2 T C 13: 54,717,915 I242T probably benign Het
Cdk4 T A 10: 127,064,237 M1K probably null Het
Cntn5 A T 9: 9,970,565 S302T probably damaging Het
Col25a1 G T 3: 130,584,701 G601V probably damaging Het
Cpb1 A G 3: 20,270,324 L62P possibly damaging Het
Cpne1 T C 2: 156,077,937 T264A probably benign Het
Cpvl T A 6: 53,947,742 N198Y probably damaging Het
Cyp2u1 A C 3: 131,297,947 L308R probably damaging Het
Ddx54 G T 5: 120,624,724 V637L probably benign Het
Dglucy C A 12: 100,857,051 P472T possibly damaging Het
Dync2h1 A G 9: 7,124,855 Y2006H probably benign Het
Eif5b T C 1: 38,050,306 M1121T possibly damaging Het
Emsy A G 7: 98,615,555 V545A possibly damaging Het
Ezh1 G A 11: 101,200,900 L480F possibly damaging Het
Fbln2 T A 6: 91,265,863 probably null Het
Gja10 T A 4: 32,602,058 K109* probably null Het
Gm28042 A G 2: 120,039,957 N762S probably benign Het
Gnb1l C A 16: 18,540,470 P7Q possibly damaging Het
Grem2 A T 1: 174,837,119 S55T probably damaging Het
Gsn A T 2: 35,296,421 N393I possibly damaging Het
H6pd T A 4: 149,982,636 Q439L probably benign Het
Hmcn2 G A 2: 31,420,830 G3362E probably damaging Het
Ighv11-2 T C 12: 114,048,358 Y79C probably damaging Het
Ikzf2 T A 1: 69,539,385 N322Y probably benign Het
Il25 A G 14: 54,933,002 I11V probably benign Het
Jak2 C T 19: 29,298,383 T741I probably damaging Het
Ldb3 T A 14: 34,567,445 Q268L probably damaging Het
Lrrc23 T A 6: 124,779,112 D6V unknown Het
Megf10 A G 18: 57,191,115 Y76C probably damaging Het
Neb A T 2: 52,220,221 M205K probably benign Het
Olfr1120 T C 2: 87,358,253 S270P probably damaging Het
Olfr151 A G 9: 37,730,687 S99P probably damaging Het
Olfr769 G T 10: 129,111,736 Q230K probably benign Het
Pcnx3 G A 19: 5,667,459 R1541W possibly damaging Het
Pdgfd A G 9: 6,359,739 Y270C probably damaging Het
Pds5b A T 5: 150,723,337 D197V probably damaging Het
Pknox2 A G 9: 36,954,831 M30T probably benign Het
Plekhg1 A T 10: 3,957,491 S858C Het
Por A T 5: 135,733,644 E400D probably benign Het
Psip1 A G 4: 83,473,038 probably null Het
Retreg1 G T 15: 25,889,542 V111F Het
Rock1 G A 18: 10,122,762 A353V probably damaging Het
Rpl6 C G 5: 121,208,528 R231G probably benign Het
Scn7a C T 2: 66,757,230 R43H probably benign Het
Scnn1g T A 7: 121,763,434 N488K probably benign Het
Slc24a1 A G 9: 64,924,482 V1111A probably benign Het
Snapc1 C T 12: 73,982,511 S356L probably benign Het
Ssbp2 T A 13: 91,675,090 N201K probably damaging Het
Tfdp2 A G 9: 96,297,642 N43D probably damaging Het
Tmprss11d A G 5: 86,326,450 I216T probably damaging Het
Tmprss4 A G 9: 45,175,555 S303P probably benign Het
Tnpo2 A G 8: 85,055,034 E815G probably benign Het
Trav6-1 A C 14: 52,638,515 M1L possibly damaging Het
Trpm3 T C 19: 22,978,573 V1133A probably damaging Het
Trpv1 C T 11: 73,238,529 P91S probably benign Het
Trpv2 T C 11: 62,589,750 Y338H probably damaging Het
Txnip T C 3: 96,560,223 M336T probably benign Het
Vmn1r61 A T 7: 5,610,768 H182Q possibly damaging Het
Vmn2r105 A G 17: 20,208,783 V677A probably damaging Het
Wwp1 G T 4: 19,627,660 T745K probably damaging Het
Xkr5 C A 8: 18,933,592 E645* probably null Het
Zfp451 C T 1: 33,779,140 R303H probably benign Het
Zyg11b T C 4: 108,266,458 H104R possibly damaging Het
Other mutations in Kdm3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Kdm3b APN 18 34809409 missense probably benign 0.03
IGL01357:Kdm3b APN 18 34793014 missense probably damaging 1.00
IGL01615:Kdm3b APN 18 34829231 missense probably damaging 1.00
IGL01980:Kdm3b APN 18 34834236 missense probably damaging 1.00
IGL02277:Kdm3b APN 18 34823664 missense probably damaging 1.00
IGL02346:Kdm3b APN 18 34834238 missense probably damaging 1.00
IGL02417:Kdm3b APN 18 34808577 missense probably benign 0.03
IGL02531:Kdm3b APN 18 34795729 missense probably benign
IGL02589:Kdm3b APN 18 34812418 missense possibly damaging 0.89
IGL02793:Kdm3b APN 18 34829019 missense probably damaging 0.99
IGL03121:Kdm3b APN 18 34795709 missense probably damaging 0.98
IGL03123:Kdm3b APN 18 34809491 critical splice donor site probably null
IGL03128:Kdm3b APN 18 34827427 missense probably damaging 1.00
PIT4382001:Kdm3b UTSW 18 34809087 missense probably damaging 1.00
PIT4445001:Kdm3b UTSW 18 34793115 nonsense probably null
R0068:Kdm3b UTSW 18 34824774 missense probably benign 0.18
R0068:Kdm3b UTSW 18 34824774 missense probably benign 0.18
R0233:Kdm3b UTSW 18 34809420 missense probably damaging 0.97
R0265:Kdm3b UTSW 18 34795663 splice site probably benign
R0306:Kdm3b UTSW 18 34804017 missense probably benign 0.35
R0941:Kdm3b UTSW 18 34803552 missense probably damaging 0.99
R0970:Kdm3b UTSW 18 34809039 missense probably damaging 1.00
R1061:Kdm3b UTSW 18 34796862 missense probably damaging 1.00
R1104:Kdm3b UTSW 18 34819811 missense probably damaging 1.00
R1221:Kdm3b UTSW 18 34808245 missense possibly damaging 0.57
R1486:Kdm3b UTSW 18 34834304 missense probably damaging 1.00
R1523:Kdm3b UTSW 18 34793173 critical splice donor site probably null
R1558:Kdm3b UTSW 18 34809096 missense probably damaging 1.00
R1585:Kdm3b UTSW 18 34809292 missense probably damaging 1.00
R1601:Kdm3b UTSW 18 34808731 missense probably damaging 1.00
R1650:Kdm3b UTSW 18 34809115 missense possibly damaging 0.93
R1772:Kdm3b UTSW 18 34803504 missense probably benign 0.01
R1853:Kdm3b UTSW 18 34833393 missense probably damaging 1.00
R1934:Kdm3b UTSW 18 34813544 missense probably benign 0.04
R1959:Kdm3b UTSW 18 34812395 missense possibly damaging 0.55
R2079:Kdm3b UTSW 18 34803517 missense probably damaging 1.00
R2102:Kdm3b UTSW 18 34830147 missense probably damaging 1.00
R2121:Kdm3b UTSW 18 34796780 splice site probably benign
R2281:Kdm3b UTSW 18 34808419 missense probably damaging 1.00
R3719:Kdm3b UTSW 18 34808671 missense probably damaging 1.00
R3755:Kdm3b UTSW 18 34808296 missense probably benign
R3857:Kdm3b UTSW 18 34833387 missense probably benign
R4165:Kdm3b UTSW 18 34795744 missense probably benign 0.01
R4166:Kdm3b UTSW 18 34795744 missense probably benign 0.01
R4372:Kdm3b UTSW 18 34827444 missense probably benign 0.00
R4672:Kdm3b UTSW 18 34808577 missense probably benign
R4933:Kdm3b UTSW 18 34810393 missense probably damaging 1.00
R4969:Kdm3b UTSW 18 34822375 missense probably damaging 1.00
R5009:Kdm3b UTSW 18 34824710 missense probably benign 0.42
R5059:Kdm3b UTSW 18 34777197 missense possibly damaging 0.83
R5092:Kdm3b UTSW 18 34813462 missense probably benign 0.16
R5270:Kdm3b UTSW 18 34827414 missense probably damaging 1.00
R5816:Kdm3b UTSW 18 34828469 missense probably damaging 0.99
R5970:Kdm3b UTSW 18 34829289 missense probably damaging 1.00
R6244:Kdm3b UTSW 18 34793005 missense probably damaging 1.00
R6705:Kdm3b UTSW 18 34819873 missense probably damaging 1.00
R6723:Kdm3b UTSW 18 34793005 missense probably damaging 0.99
R6909:Kdm3b UTSW 18 34827328 splice site probably null
R6958:Kdm3b UTSW 18 34808283 missense probably benign 0.00
R7026:Kdm3b UTSW 18 34822464 missense possibly damaging 0.90
R7289:Kdm3b UTSW 18 34794504 missense probably benign 0.00
R7587:Kdm3b UTSW 18 34797027 intron probably null
R7695:Kdm3b UTSW 18 34794559 missense possibly damaging 0.86
R7846:Kdm3b UTSW 18 34809240 missense possibly damaging 0.94
R7929:Kdm3b UTSW 18 34809240 missense possibly damaging 0.94
R7997:Kdm3b UTSW 18 34808283 missense probably benign 0.00
R8035:Kdm3b UTSW 18 34808728 missense probably damaging 1.00
R8064:Kdm3b UTSW 18 34813407 critical splice acceptor site probably null
X0028:Kdm3b UTSW 18 34799266 intron probably null
X0067:Kdm3b UTSW 18 34823517 missense probably benign 0.00
Z1176:Kdm3b UTSW 18 34809069 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGTCAGTGTCTGCTGTGTTC -3'
(R):5'- GCTTGACCACGTAACTAGGAG -3'

Sequencing Primer
(F):5'- GTTCTTACAGATGCAGGGTCCC -3'
(R):5'- CTAGGAGACTCTCACTAGATCTGTG -3'
Posted On2019-10-07