Incidental Mutation 'R7489:Adgrb3'
ID580382
Institutional Source Beutler Lab
Gene Symbol Adgrb3
Ensembl Gene ENSMUSG00000033569
Gene Nameadhesion G protein-coupled receptor B3
SynonymsBai3, A830096D10Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R7489 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location25067476-25829707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25547505 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 369 (T369I)
Ref Sequence ENSEMBL: ENSMUSP00000035612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041838] [ENSMUST00000135518] [ENSMUST00000146592] [ENSMUST00000151309]
Predicted Effect probably damaging
Transcript: ENSMUST00000041838
AA Change: T369I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035612
Gene: ENSMUSG00000033569
AA Change: T369I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135518
AA Change: T369I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119804
Gene: ENSMUSG00000033569
AA Change: T369I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:DUF3497 586 810 1.7e-52 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 874 1143 2.1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146592
AA Change: T162I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116759
Gene: ENSMUSG00000033569
AA Change: T162I

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
TSP1 87 136 2.1e-12 SMART
TSP1 141 191 7.97e-13 SMART
TSP1 196 246 6.28e-11 SMART
TSP1 251 301 1.48e-7 SMART
HormR 303 369 4.15e-20 SMART
Pfam:DUF3497 379 603 2.5e-52 PFAM
GPS 608 661 1.24e-21 SMART
Pfam:7tm_2 667 903 5.4e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151309
AA Change: T369I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116231
Gene: ENSMUSG00000033569
AA Change: T369I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
TSP1 294 343 2.1e-12 SMART
TSP1 348 398 7.97e-13 SMART
TSP1 403 453 6.28e-11 SMART
TSP1 458 508 1.48e-7 SMART
HormR 510 576 4.15e-20 SMART
Pfam:GAIN 589 794 1.1e-44 PFAM
GPS 815 868 1.24e-21 SMART
Pfam:7tm_2 875 1143 2.7e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in Purkinje cells exhibit impaired motor learning with alterned climbing fiber electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A T 16: 88,627,234 V123D probably damaging Het
4930503E14Rik A T 14: 44,170,299 N92K probably damaging Het
4930519G04Rik T C 5: 114,879,625 S166P unknown Het
Agbl4 T C 4: 111,526,658 S237P probably damaging Het
Ahi1 T C 10: 20,963,750 C187R probably benign Het
Akap9 C T 5: 4,004,933 T1626M probably damaging Het
Alas1 A T 9: 106,241,634 probably null Het
Apbb1 G T 7: 105,567,480 T301N probably benign Het
Arhgap42 A G 9: 9,006,358 V679A probably benign Het
Atp2a2 T C 5: 122,467,767 D375G probably benign Het
Best1 A G 19: 9,997,046 S45P possibly damaging Het
Bpifb4 A C 2: 153,944,004 T21P probably damaging Het
Btbd11 T A 10: 85,627,215 Y615N probably damaging Het
Cdx2 A T 5: 147,306,672 M104K probably benign Het
Ces1d A T 8: 93,178,131 L327Q probably damaging Het
Ces2e A G 8: 104,929,780 H214R probably benign Het
Chd5 G A 4: 152,373,468 G1014D probably damaging Het
Cmya5 T A 13: 93,091,838 K2247N possibly damaging Het
Dip2c T C 13: 9,533,312 V110A probably damaging Het
Fam71b G C 11: 46,407,441 G524A Het
Fancd2 T C 6: 113,564,304 S724P probably benign Het
Galnt1 T A 18: 24,282,157 V485D probably damaging Het
Gli2 A G 1: 118,838,175 S749P probably benign Het
H2-M5 A C 17: 36,989,471 L12V unknown Het
Iqcf6 C A 9: 106,627,457 Q107K probably benign Het
Itfg1 C T 8: 85,767,001 C283Y probably damaging Het
Jak3 A C 8: 71,684,292 K704T probably damaging Het
Kl A T 5: 150,952,996 T94S probably damaging Het
Krt73 A C 15: 101,793,859 V523G probably benign Het
Lap3 T C 5: 45,500,506 F215L probably damaging Het
Lce1c G A 3: 92,680,647 C127Y unknown Het
Map6 C T 7: 99,268,061 R14C probably damaging Het
Mcm10 T A 2: 5,001,301 K410M probably damaging Het
Med23 T A 10: 24,904,356 N967K probably damaging Het
Mmp8 A T 9: 7,561,387 T131S probably benign Het
Ms4a14 T C 19: 11,302,031 I1054M probably benign Het
Mup14 A G 4: 61,303,888 M1T probably null Het
Myzap T A 9: 71,561,038 T110S probably benign Het
Nmrk1 A T 19: 18,642,242 K153M probably damaging Het
Nmrk1 G T 19: 18,642,243 K153N possibly damaging Het
Olfr1267-ps1 T A 2: 90,086,360 M34L probably benign Het
Olfr814 A T 10: 129,874,682 I25N probably damaging Het
Pcdh12 T C 18: 38,281,789 H761R possibly damaging Het
Pde4d C A 13: 109,116,767 L43I unknown Het
Prrc2a A T 17: 35,162,354 S46R unknown Het
Rab19 A G 6: 39,388,105 T100A probably benign Het
Rad51b C T 12: 79,300,585 R8* probably null Het
Sclt1 A T 3: 41,629,597 L642Q probably damaging Het
Scyl3 T C 1: 163,949,176 I392T possibly damaging Het
Sipa1l3 A G 7: 29,366,702 W1076R probably damaging Het
Slc12a9 C A 5: 137,322,820 A478S probably damaging Het
Slc5a9 C A 4: 111,883,916 C511F probably damaging Het
Sspo T C 6: 48,473,713 L2612P probably damaging Het
Synrg C T 11: 83,990,825 T329I probably benign Het
Tdrd9 A G 12: 112,067,637 T1338A probably benign Het
Tenm4 A T 7: 96,837,314 D996V possibly damaging Het
Ticam2 T A 18: 46,560,517 I168L probably damaging Het
Tom1l1 T C 11: 90,656,359 I374M probably benign Het
Trip10 A T 17: 57,250,966 K51I probably damaging Het
Trpc6 T A 9: 8,656,544 D735E probably benign Het
Trpm8 T A 1: 88,379,759 N1050K possibly damaging Het
Tuba8 A T 6: 121,226,021 D431V probably damaging Het
Ucn2 C T 9: 108,986,254 T28I possibly damaging Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Vmn2r8 T C 5: 108,797,656 N695S possibly damaging Het
Xirp2 A C 2: 67,525,560 N3555T possibly damaging Het
Zfp119a A T 17: 55,866,158 H228Q probably damaging Het
Zfr T A 15: 12,152,982 H566Q probably benign Het
Other mutations in Adgrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Adgrb3 APN 1 25228500 missense probably benign 0.09
IGL00507:Adgrb3 APN 1 25074715 missense possibly damaging 0.93
IGL00828:Adgrb3 APN 1 25488119 missense possibly damaging 0.73
IGL01285:Adgrb3 APN 1 25093787 missense probably benign 0.32
IGL01309:Adgrb3 APN 1 25112271 missense possibly damaging 0.69
IGL01540:Adgrb3 APN 1 25112171 splice site probably null
IGL01608:Adgrb3 APN 1 25553774 missense probably damaging 1.00
IGL01638:Adgrb3 APN 1 25559751 splice site probably benign
IGL01657:Adgrb3 APN 1 25826493 missense probably benign 0.03
IGL01666:Adgrb3 APN 1 25460751 missense probably damaging 0.96
IGL01712:Adgrb3 APN 1 25826279 missense probably benign
IGL01767:Adgrb3 APN 1 25559814 missense probably benign 0.00
IGL01987:Adgrb3 APN 1 25101431 critical splice donor site probably null
IGL02201:Adgrb3 APN 1 25420550 splice site probably benign
IGL02584:Adgrb3 APN 1 25504984 missense probably damaging 0.98
IGL02685:Adgrb3 APN 1 25084242 critical splice donor site probably null
IGL02886:Adgrb3 APN 1 25504910 splice site probably null
IGL02929:Adgrb3 APN 1 25553824 missense probably benign 0.00
IGL03153:Adgrb3 APN 1 25531897 nonsense probably null
IGL03165:Adgrb3 APN 1 25094394 missense probably benign 0.05
IGL03227:Adgrb3 APN 1 25547475 missense probably damaging 1.00
IGL03392:Adgrb3 APN 1 25504448 missense probably damaging 0.99
schwach UTSW 1 25111691 critical splice donor site probably null
R0007:Adgrb3 UTSW 1 25111691 critical splice donor site probably null
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0048:Adgrb3 UTSW 1 25101482 missense probably benign 0.02
R0322:Adgrb3 UTSW 1 25221748 splice site probably benign
R0442:Adgrb3 UTSW 1 25396470 missense probably damaging 0.96
R0563:Adgrb3 UTSW 1 25547554 missense probably damaging 0.99
R1168:Adgrb3 UTSW 1 25826199 missense probably benign
R1252:Adgrb3 UTSW 1 25128828 missense probably damaging 1.00
R1264:Adgrb3 UTSW 1 25559850 missense probably damaging 0.97
R1543:Adgrb3 UTSW 1 25488088 missense probably benign 0.01
R1577:Adgrb3 UTSW 1 25094183 missense possibly damaging 0.51
R1581:Adgrb3 UTSW 1 25094072 missense possibly damaging 0.94
R1583:Adgrb3 UTSW 1 25226831 splice site probably null
R1653:Adgrb3 UTSW 1 25101503 missense probably benign 0.09
R1725:Adgrb3 UTSW 1 25826300 missense probably damaging 1.00
R1792:Adgrb3 UTSW 1 25228471 missense probably damaging 1.00
R1827:Adgrb3 UTSW 1 25532577 missense probably damaging 0.99
R1838:Adgrb3 UTSW 1 25084270 missense probably damaging 1.00
R1869:Adgrb3 UTSW 1 25826438 missense possibly damaging 0.83
R1971:Adgrb3 UTSW 1 25547444 missense probably benign 0.02
R2005:Adgrb3 UTSW 1 25111718 missense probably benign 0.25
R2134:Adgrb3 UTSW 1 25093957 missense probably damaging 0.99
R2142:Adgrb3 UTSW 1 25068209 missense probably damaging 1.00
R2268:Adgrb3 UTSW 1 25111817 missense possibly damaging 0.79
R3740:Adgrb3 UTSW 1 25826454 missense probably benign 0.00
R3877:Adgrb3 UTSW 1 25111825 missense probably damaging 1.00
R4120:Adgrb3 UTSW 1 25094307 nonsense probably null
R4344:Adgrb3 UTSW 1 25826748 missense possibly damaging 0.61
R4363:Adgrb3 UTSW 1 25112222 missense probably damaging 1.00
R4438:Adgrb3 UTSW 1 25831027 unclassified probably benign
R4465:Adgrb3 UTSW 1 25094366 missense probably damaging 1.00
R4480:Adgrb3 UTSW 1 25111748 missense probably damaging 1.00
R4554:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4557:Adgrb3 UTSW 1 25084279 missense probably damaging 1.00
R4622:Adgrb3 UTSW 1 25826488 missense probably damaging 0.99
R4713:Adgrb3 UTSW 1 25547532 missense probably damaging 1.00
R4772:Adgrb3 UTSW 1 25531875 missense probably damaging 1.00
R4890:Adgrb3 UTSW 1 25221827 missense probably damaging 1.00
R5045:Adgrb3 UTSW 1 25074779 missense probably damaging 1.00
R5061:Adgrb3 UTSW 1 25068128 utr 3 prime probably benign
R5097:Adgrb3 UTSW 1 25826084 missense probably damaging 1.00
R5227:Adgrb3 UTSW 1 25093952 missense possibly damaging 0.55
R5241:Adgrb3 UTSW 1 25111790 missense possibly damaging 0.85
R5328:Adgrb3 UTSW 1 25094275 missense possibly damaging 0.90
R5372:Adgrb3 UTSW 1 25128859 missense probably benign 0.01
R5703:Adgrb3 UTSW 1 25420559 missense probably damaging 1.00
R5747:Adgrb3 UTSW 1 25826562 missense probably damaging 1.00
R5998:Adgrb3 UTSW 1 25431501 splice site probably null
R6006:Adgrb3 UTSW 1 25826531 missense possibly damaging 0.85
R6077:Adgrb3 UTSW 1 25094000 nonsense probably null
R6183:Adgrb3 UTSW 1 25094370 missense probably damaging 0.98
R6190:Adgrb3 UTSW 1 25420647 missense probably benign 0.01
R6249:Adgrb3 UTSW 1 25432558 missense probably damaging 1.00
R6310:Adgrb3 UTSW 1 25111718 missense probably benign 0.13
R6450:Adgrb3 UTSW 1 25420602 missense probably benign
R6678:Adgrb3 UTSW 1 25460810 missense possibly damaging 0.84
R6679:Adgrb3 UTSW 1 25131296 missense probably benign 0.01
R6685:Adgrb3 UTSW 1 25111736 nonsense probably null
R6730:Adgrb3 UTSW 1 25094294 missense probably damaging 1.00
R6805:Adgrb3 UTSW 1 25826172 missense possibly damaging 0.83
R6847:Adgrb3 UTSW 1 25093922 missense probably benign 0.03
R6929:Adgrb3 UTSW 1 25111771 nonsense probably null
R6953:Adgrb3 UTSW 1 25826511 missense probably damaging 1.00
R7062:Adgrb3 UTSW 1 25826085 missense possibly damaging 0.90
R7244:Adgrb3 UTSW 1 25131269 missense probably damaging 1.00
R7292:Adgrb3 UTSW 1 25531876 missense probably damaging 1.00
R7325:Adgrb3 UTSW 1 25532630 missense probably benign 0.01
R7378:Adgrb3 UTSW 1 25531919 nonsense probably null
R7615:Adgrb3 UTSW 1 25098897 missense probably damaging 1.00
R7623:Adgrb3 UTSW 1 25547548 missense probably damaging 1.00
Z1088:Adgrb3 UTSW 1 25131271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACACTTTTCAGCAAGGC -3'
(R):5'- AGCTCTAAAAGTTCAGCCCTG -3'

Sequencing Primer
(F):5'- TTCAGCAAGGCTCAATAAGAGTTG -3'
(R):5'- GCTCTAAAAGTTCAGCCCTGTTATG -3'
Posted On2019-10-07