Incidental Mutation 'R7489:Mcm10'
ID580386
Institutional Source Beutler Lab
Gene Symbol Mcm10
Ensembl Gene ENSMUSG00000026669
Gene Nameminichromosome maintenance 10 replication initiation factor
SynonymsC330019M07Rik, 2410041F14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7489 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location4989714-5012791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5001301 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 410 (K410M)
Ref Sequence ENSEMBL: ENSMUSP00000027980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027980] [ENSMUST00000102985]
Predicted Effect probably damaging
Transcript: ENSMUST00000027980
AA Change: K410M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027980
Gene: ENSMUSG00000026669
AA Change: K410M

DomainStartEndE-ValueType
coiled coil region 102 138 N/A INTRINSIC
low complexity region 218 228 N/A INTRINSIC
Pfam:zf-primase 398 443 2e-21 PFAM
low complexity region 480 493 N/A INTRINSIC
Mcm10 538 883 2.27e-184 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102985
AA Change: K410M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100050
Gene: ENSMUSG00000026669
AA Change: K410M

DomainStartEndE-ValueType
coiled coil region 102 138 N/A INTRINSIC
low complexity region 218 228 N/A INTRINSIC
Pfam:zf-primase 398 443 3.7e-21 PFAM
low complexity region 480 493 N/A INTRINSIC
Mcm10 538 883 2.27e-184 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre-RC) and it may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein can interact with MCM2 and MCM6, as well as with the origin recognition protein ORC2. It is regulated by proteolysis and phosphorylation in a cell cycle-dependent manner. Studies of a similar protein in Xenopus suggest that the chromatin binding of this protein at the onset of DNA replication is after pre-RC assembly and before origin unwinding. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced embryonic cell proliferation and early embryonic letahlity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A T 16: 88,627,234 V123D probably damaging Het
4930503E14Rik A T 14: 44,170,299 N92K probably damaging Het
4930519G04Rik T C 5: 114,879,625 S166P unknown Het
Adgrb3 G A 1: 25,547,505 T369I probably damaging Het
Agbl4 T C 4: 111,526,658 S237P probably damaging Het
Ahi1 T C 10: 20,963,750 C187R probably benign Het
Akap9 C T 5: 4,004,933 T1626M probably damaging Het
Alas1 A T 9: 106,241,634 probably null Het
Apbb1 G T 7: 105,567,480 T301N probably benign Het
Arhgap42 A G 9: 9,006,358 V679A probably benign Het
Atp2a2 T C 5: 122,467,767 D375G probably benign Het
Best1 A G 19: 9,997,046 S45P possibly damaging Het
Bpifb4 A C 2: 153,944,004 T21P probably damaging Het
Btbd11 T A 10: 85,627,215 Y615N probably damaging Het
Cdx2 A T 5: 147,306,672 M104K probably benign Het
Ces1d A T 8: 93,178,131 L327Q probably damaging Het
Ces2e A G 8: 104,929,780 H214R probably benign Het
Chd5 G A 4: 152,373,468 G1014D probably damaging Het
Cmya5 T A 13: 93,091,838 K2247N possibly damaging Het
Dip2c T C 13: 9,533,312 V110A probably damaging Het
Fam71b G C 11: 46,407,441 G524A Het
Fancd2 T C 6: 113,564,304 S724P probably benign Het
Galnt1 T A 18: 24,282,157 V485D probably damaging Het
Gli2 A G 1: 118,838,175 S749P probably benign Het
H2-M5 A C 17: 36,989,471 L12V unknown Het
Iqcf6 C A 9: 106,627,457 Q107K probably benign Het
Itfg1 C T 8: 85,767,001 C283Y probably damaging Het
Jak3 A C 8: 71,684,292 K704T probably damaging Het
Kl A T 5: 150,952,996 T94S probably damaging Het
Krt73 A C 15: 101,793,859 V523G probably benign Het
Lap3 T C 5: 45,500,506 F215L probably damaging Het
Lce1c G A 3: 92,680,647 C127Y unknown Het
Map6 C T 7: 99,268,061 R14C probably damaging Het
Med23 T A 10: 24,904,356 N967K probably damaging Het
Mmp8 A T 9: 7,561,387 T131S probably benign Het
Ms4a14 T C 19: 11,302,031 I1054M probably benign Het
Mup14 A G 4: 61,303,888 M1T probably null Het
Myzap T A 9: 71,561,038 T110S probably benign Het
Nmrk1 G T 19: 18,642,243 K153N possibly damaging Het
Nmrk1 A T 19: 18,642,242 K153M probably damaging Het
Olfr1267-ps1 T A 2: 90,086,360 M34L probably benign Het
Olfr814 A T 10: 129,874,682 I25N probably damaging Het
Pcdh12 T C 18: 38,281,789 H761R possibly damaging Het
Pde4d C A 13: 109,116,767 L43I unknown Het
Prrc2a A T 17: 35,162,354 S46R unknown Het
Rab19 A G 6: 39,388,105 T100A probably benign Het
Rad51b C T 12: 79,300,585 R8* probably null Het
Sclt1 A T 3: 41,629,597 L642Q probably damaging Het
Scyl3 T C 1: 163,949,176 I392T possibly damaging Het
Sipa1l3 A G 7: 29,366,702 W1076R probably damaging Het
Slc12a9 C A 5: 137,322,820 A478S probably damaging Het
Slc5a9 C A 4: 111,883,916 C511F probably damaging Het
Sspo T C 6: 48,473,713 L2612P probably damaging Het
Synrg C T 11: 83,990,825 T329I probably benign Het
Tdrd9 A G 12: 112,067,637 T1338A probably benign Het
Tenm4 A T 7: 96,837,314 D996V possibly damaging Het
Ticam2 T A 18: 46,560,517 I168L probably damaging Het
Tom1l1 T C 11: 90,656,359 I374M probably benign Het
Trip10 A T 17: 57,250,966 K51I probably damaging Het
Trpc6 T A 9: 8,656,544 D735E probably benign Het
Trpm8 T A 1: 88,379,759 N1050K possibly damaging Het
Tuba8 A T 6: 121,226,021 D431V probably damaging Het
Ucn2 C T 9: 108,986,254 T28I possibly damaging Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Vmn2r8 T C 5: 108,797,656 N695S possibly damaging Het
Xirp2 A C 2: 67,525,560 N3555T possibly damaging Het
Zfp119a A T 17: 55,866,158 H228Q probably damaging Het
Zfr T A 15: 12,152,982 H566Q probably benign Het
Other mutations in Mcm10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Mcm10 APN 2 5008628 missense probably benign 0.00
IGL02028:Mcm10 APN 2 5008700 missense possibly damaging 0.95
IGL02672:Mcm10 APN 2 5001281 missense probably benign 0.00
IGL03352:Mcm10 APN 2 4994596 missense probably damaging 1.00
R0055:Mcm10 UTSW 2 4991407 missense probably damaging 1.00
R0055:Mcm10 UTSW 2 4991407 missense probably damaging 1.00
R0320:Mcm10 UTSW 2 5004086 missense probably benign
R0379:Mcm10 UTSW 2 5008623 missense probably benign 0.05
R0385:Mcm10 UTSW 2 5004154 missense possibly damaging 0.82
R0519:Mcm10 UTSW 2 5008545 missense probably benign
R1537:Mcm10 UTSW 2 4998780 missense possibly damaging 0.77
R1597:Mcm10 UTSW 2 4998752 missense probably damaging 1.00
R1727:Mcm10 UTSW 2 5006525 missense probably benign 0.10
R1758:Mcm10 UTSW 2 5004050 missense probably damaging 1.00
R1997:Mcm10 UTSW 2 4993760 missense probably damaging 1.00
R3618:Mcm10 UTSW 2 4997102 critical splice donor site probably null
R4005:Mcm10 UTSW 2 5001003 missense probably damaging 1.00
R4870:Mcm10 UTSW 2 5004159 missense probably damaging 1.00
R5302:Mcm10 UTSW 2 5007370 missense probably benign 0.12
R5488:Mcm10 UTSW 2 4992118 missense probably damaging 1.00
R6921:Mcm10 UTSW 2 5000935 missense probably benign 0.00
R7259:Mcm10 UTSW 2 5006517 missense probably benign 0.02
R7353:Mcm10 UTSW 2 5007109 missense possibly damaging 0.54
R7744:Mcm10 UTSW 2 4991442 missense probably damaging 1.00
R7903:Mcm10 UTSW 2 4995802 missense probably benign 0.00
X0020:Mcm10 UTSW 2 5007148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCAGTATTCACAGTCATGC -3'
(R):5'- TTCACGTGCCTTCCAAAACC -3'

Sequencing Primer
(F):5'- GGGACACCCATCTCTCCTAG -3'
(R):5'- CAGCTCAGACTGACCTTCG -3'
Posted On2019-10-07