Incidental Mutation 'R7489:Slc5a9'
ID 580394
Institutional Source Beutler Lab
Gene Symbol Slc5a9
Ensembl Gene ENSMUSG00000028544
Gene Name solute carrier family 5 (sodium/glucose cotransporter), member 9
Synonyms SGLT4
MMRRC Submission 045563-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R7489 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 111732571-111759993 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 111741113 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 511 (C511F)
Ref Sequence ENSEMBL: ENSMUSP00000099780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102719] [ENSMUST00000102720] [ENSMUST00000102721]
AlphaFold Q8VDT1
Predicted Effect probably damaging
Transcript: ENSMUST00000102719
AA Change: C511F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099780
Gene: ENSMUSG00000028544
AA Change: C511F

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102720
AA Change: C511F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099781
Gene: ENSMUSG00000028544
AA Change: C511F

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102721
AA Change: C511F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099782
Gene: ENSMUSG00000028544
AA Change: C511F

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:SSF 63 492 2.3e-152 PFAM
transmembrane domain 526 548 N/A INTRINSIC
transmembrane domain 665 684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A T 16: 88,424,122 (GRCm39) V123D probably damaging Het
4930503E14Rik A T 14: 44,407,756 (GRCm39) N92K probably damaging Het
4930519G04Rik T C 5: 115,017,686 (GRCm39) S166P unknown Het
Abtb3 T A 10: 85,463,079 (GRCm39) Y615N probably damaging Het
Adgrb3 G A 1: 25,586,586 (GRCm39) T369I probably damaging Het
Agbl4 T C 4: 111,383,855 (GRCm39) S237P probably damaging Het
Ahi1 T C 10: 20,839,649 (GRCm39) C187R probably benign Het
Akap9 C T 5: 4,054,933 (GRCm39) T1626M probably damaging Het
Alas1 A T 9: 106,118,833 (GRCm39) probably null Het
Apbb1 G T 7: 105,216,687 (GRCm39) T301N probably benign Het
Arhgap42 A G 9: 9,006,359 (GRCm39) V679A probably benign Het
Atp2a2 T C 5: 122,605,830 (GRCm39) D375G probably benign Het
Best1 A G 19: 9,974,410 (GRCm39) S45P possibly damaging Het
Bpifb4 A C 2: 153,785,924 (GRCm39) T21P probably damaging Het
Cdx2 A T 5: 147,243,482 (GRCm39) M104K probably benign Het
Ces1d A T 8: 93,904,759 (GRCm39) L327Q probably damaging Het
Ces2e A G 8: 105,656,412 (GRCm39) H214R probably benign Het
Chd5 G A 4: 152,457,925 (GRCm39) G1014D probably damaging Het
Cmya5 T A 13: 93,228,346 (GRCm39) K2247N possibly damaging Het
Dip2c T C 13: 9,583,348 (GRCm39) V110A probably damaging Het
Fancd2 T C 6: 113,541,265 (GRCm39) S724P probably benign Het
Galnt1 T A 18: 24,415,214 (GRCm39) V485D probably damaging Het
Garin3 G C 11: 46,298,268 (GRCm39) G524A Het
Gli2 A G 1: 118,765,905 (GRCm39) S749P probably benign Het
H2-M5 A C 17: 37,300,363 (GRCm39) L12V unknown Het
Iqcf6 C A 9: 106,504,656 (GRCm39) Q107K probably benign Het
Itfg1 C T 8: 86,493,630 (GRCm39) C283Y probably damaging Het
Jak3 A C 8: 72,136,936 (GRCm39) K704T probably damaging Het
Kl A T 5: 150,876,461 (GRCm39) T94S probably damaging Het
Krt73 A C 15: 101,702,294 (GRCm39) V523G probably benign Het
Lap3 T C 5: 45,657,848 (GRCm39) F215L probably damaging Het
Lce1c G A 3: 92,587,954 (GRCm39) C127Y unknown Het
Map6 C T 7: 98,917,268 (GRCm39) R14C probably damaging Het
Mcm10 T A 2: 5,006,112 (GRCm39) K410M probably damaging Het
Med23 T A 10: 24,780,254 (GRCm39) N967K probably damaging Het
Mmp8 A T 9: 7,561,388 (GRCm39) T131S probably benign Het
Ms4a14 T C 19: 11,279,395 (GRCm39) I1054M probably benign Het
Mup14 A G 4: 61,259,887 (GRCm39) M1T probably null Het
Myzap T A 9: 71,468,320 (GRCm39) T110S probably benign Het
Nmrk1 A T 19: 18,619,606 (GRCm39) K153M probably damaging Het
Nmrk1 G T 19: 18,619,607 (GRCm39) K153N possibly damaging Het
Or4x12-ps1 T A 2: 89,916,704 (GRCm39) M34L probably benign Het
Or6c70 A T 10: 129,710,551 (GRCm39) I25N probably damaging Het
Pcdh12 T C 18: 38,414,842 (GRCm39) H761R possibly damaging Het
Pde4d C A 13: 109,253,301 (GRCm39) L43I unknown Het
Prrc2a A T 17: 35,381,330 (GRCm39) S46R unknown Het
Rab19 A G 6: 39,365,039 (GRCm39) T100A probably benign Het
Rad51b C T 12: 79,347,359 (GRCm39) R8* probably null Het
Sclt1 A T 3: 41,584,032 (GRCm39) L642Q probably damaging Het
Scyl3 T C 1: 163,776,745 (GRCm39) I392T possibly damaging Het
Sipa1l3 A G 7: 29,066,127 (GRCm39) W1076R probably damaging Het
Slc12a9 C A 5: 137,321,082 (GRCm39) A478S probably damaging Het
Sspo T C 6: 48,450,647 (GRCm39) L2612P probably damaging Het
Synrg C T 11: 83,881,651 (GRCm39) T329I probably benign Het
Tdrd9 A G 12: 112,034,071 (GRCm39) T1338A probably benign Het
Tenm4 A T 7: 96,486,521 (GRCm39) D996V possibly damaging Het
Ticam2 T A 18: 46,693,584 (GRCm39) I168L probably damaging Het
Tom1l1 T C 11: 90,547,185 (GRCm39) I374M probably benign Het
Trip10 A T 17: 57,557,966 (GRCm39) K51I probably damaging Het
Trpc6 T A 9: 8,656,545 (GRCm39) D735E probably benign Het
Trpm8 T A 1: 88,307,481 (GRCm39) N1050K possibly damaging Het
Tuba8 A T 6: 121,202,980 (GRCm39) D431V probably damaging Het
Ucn2 C T 9: 108,815,322 (GRCm39) T28I possibly damaging Het
Vmn1r21 C T 6: 57,820,877 (GRCm39) G189D probably damaging Het
Vmn2r8 T C 5: 108,945,522 (GRCm39) N695S possibly damaging Het
Xirp2 A C 2: 67,355,904 (GRCm39) N3555T possibly damaging Het
Zfp119a A T 17: 56,173,158 (GRCm39) H228Q probably damaging Het
Zfr T A 15: 12,153,068 (GRCm39) H566Q probably benign Het
Other mutations in Slc5a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Slc5a9 APN 4 111,755,766 (GRCm39) missense probably damaging 0.99
IGL00837:Slc5a9 APN 4 111,750,887 (GRCm39) intron probably benign
IGL01556:Slc5a9 APN 4 111,755,833 (GRCm39) missense probably benign 0.00
IGL01807:Slc5a9 APN 4 111,734,737 (GRCm39) makesense probably null
IGL01816:Slc5a9 APN 4 111,755,811 (GRCm39) missense probably damaging 1.00
IGL02066:Slc5a9 APN 4 111,744,719 (GRCm39) missense probably damaging 1.00
IGL02370:Slc5a9 APN 4 111,734,826 (GRCm39) missense probably benign 0.01
IGL02491:Slc5a9 APN 4 111,753,549 (GRCm39) missense probably damaging 0.99
IGL02971:Slc5a9 APN 4 111,747,497 (GRCm39) missense possibly damaging 0.58
IGL03008:Slc5a9 APN 4 111,748,138 (GRCm39) missense probably benign 0.14
R0365:Slc5a9 UTSW 4 111,749,033 (GRCm39) nonsense probably null
R0559:Slc5a9 UTSW 4 111,742,779 (GRCm39) missense probably benign 0.02
R0659:Slc5a9 UTSW 4 111,741,068 (GRCm39) missense possibly damaging 0.82
R1454:Slc5a9 UTSW 4 111,741,161 (GRCm39) missense probably benign 0.04
R2006:Slc5a9 UTSW 4 111,737,423 (GRCm39) missense probably benign
R2014:Slc5a9 UTSW 4 111,753,546 (GRCm39) missense possibly damaging 0.76
R2024:Slc5a9 UTSW 4 111,747,728 (GRCm39) missense probably damaging 1.00
R2076:Slc5a9 UTSW 4 111,742,770 (GRCm39) missense possibly damaging 0.76
R2152:Slc5a9 UTSW 4 111,750,420 (GRCm39) missense possibly damaging 0.76
R3156:Slc5a9 UTSW 4 111,747,421 (GRCm39) missense possibly damaging 0.80
R4566:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R4568:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R4579:Slc5a9 UTSW 4 111,750,384 (GRCm39) missense probably damaging 1.00
R4656:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R4657:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R4700:Slc5a9 UTSW 4 111,748,134 (GRCm39) missense possibly damaging 0.64
R4889:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R4891:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R4911:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R4948:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R4953:Slc5a9 UTSW 4 111,748,941 (GRCm39) splice site probably null
R5222:Slc5a9 UTSW 4 111,755,808 (GRCm39) missense possibly damaging 0.55
R5376:Slc5a9 UTSW 4 111,750,414 (GRCm39) missense possibly damaging 0.80
R5502:Slc5a9 UTSW 4 111,750,366 (GRCm39) nonsense probably null
R5851:Slc5a9 UTSW 4 111,742,797 (GRCm39) missense probably benign
R6030:Slc5a9 UTSW 4 111,742,725 (GRCm39) missense possibly damaging 0.64
R6030:Slc5a9 UTSW 4 111,742,725 (GRCm39) missense possibly damaging 0.64
R6125:Slc5a9 UTSW 4 111,741,002 (GRCm39) missense probably damaging 1.00
R6326:Slc5a9 UTSW 4 111,737,450 (GRCm39) missense probably benign
R6438:Slc5a9 UTSW 4 111,749,022 (GRCm39) missense probably benign 0.00
R7105:Slc5a9 UTSW 4 111,755,892 (GRCm39) missense probably benign
R7166:Slc5a9 UTSW 4 111,741,036 (GRCm39) missense probably benign 0.04
R7599:Slc5a9 UTSW 4 111,734,937 (GRCm39) missense probably benign
R7662:Slc5a9 UTSW 4 111,734,737 (GRCm39) makesense probably null
R7762:Slc5a9 UTSW 4 111,747,371 (GRCm39) missense probably damaging 0.99
R7992:Slc5a9 UTSW 4 111,747,729 (GRCm39) missense probably benign 0.37
R8851:Slc5a9 UTSW 4 111,755,790 (GRCm39) missense probably damaging 0.97
R8918:Slc5a9 UTSW 4 111,741,147 (GRCm39) missense probably benign 0.00
R9387:Slc5a9 UTSW 4 111,750,864 (GRCm39) missense probably damaging 1.00
R9425:Slc5a9 UTSW 4 111,734,803 (GRCm39) missense probably damaging 0.96
R9483:Slc5a9 UTSW 4 111,747,418 (GRCm39) missense probably damaging 1.00
R9506:Slc5a9 UTSW 4 111,750,439 (GRCm39) nonsense probably null
X0012:Slc5a9 UTSW 4 111,750,511 (GRCm39) missense probably damaging 0.99
Z1177:Slc5a9 UTSW 4 111,749,013 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGAGACCATGATCCAGCAGG -3'
(R):5'- TGTTAGAGCATGGTGTCTCAC -3'

Sequencing Primer
(F):5'- CAGGATGTAACCCAACGGACG -3'
(R):5'- GTGTCTCACCTTCCTAGGATCTC -3'
Posted On 2019-10-07