Incidental Mutation 'R7489:Map6'
ID 580411
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms F-STOP, Mtap6, 2810411E12Rik, STOP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock # R7489 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 99267447-99337137 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 99268061 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 14 (R14C)
Ref Sequence ENSEMBL: ENSMUSP00000064787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000127492] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
AlphaFold Q7TSJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000068973
AA Change: R14C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: R14C

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000122101
AA Change: R14C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407
AA Change: R14C

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000127492
AA Change: R14C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000207883
AA Change: R14C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208605
Predicted Effect probably benign
Transcript: ENSMUST00000208924
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A T 16: 88,627,234 V123D probably damaging Het
4930503E14Rik A T 14: 44,170,299 N92K probably damaging Het
4930519G04Rik T C 5: 114,879,625 S166P unknown Het
Adgrb3 G A 1: 25,547,505 T369I probably damaging Het
Agbl4 T C 4: 111,526,658 S237P probably damaging Het
Ahi1 T C 10: 20,963,750 C187R probably benign Het
Akap9 C T 5: 4,004,933 T1626M probably damaging Het
Alas1 A T 9: 106,241,634 probably null Het
Apbb1 G T 7: 105,567,480 T301N probably benign Het
Arhgap42 A G 9: 9,006,358 V679A probably benign Het
Atp2a2 T C 5: 122,467,767 D375G probably benign Het
Best1 A G 19: 9,997,046 S45P possibly damaging Het
Bpifb4 A C 2: 153,944,004 T21P probably damaging Het
Btbd11 T A 10: 85,627,215 Y615N probably damaging Het
Cdx2 A T 5: 147,306,672 M104K probably benign Het
Ces1d A T 8: 93,178,131 L327Q probably damaging Het
Ces2e A G 8: 104,929,780 H214R probably benign Het
Chd5 G A 4: 152,373,468 G1014D probably damaging Het
Cmya5 T A 13: 93,091,838 K2247N possibly damaging Het
Dip2c T C 13: 9,533,312 V110A probably damaging Het
Fam71b G C 11: 46,407,441 G524A Het
Fancd2 T C 6: 113,564,304 S724P probably benign Het
Galnt1 T A 18: 24,282,157 V485D probably damaging Het
Gli2 A G 1: 118,838,175 S749P probably benign Het
H2-M5 A C 17: 36,989,471 L12V unknown Het
Iqcf6 C A 9: 106,627,457 Q107K probably benign Het
Itfg1 C T 8: 85,767,001 C283Y probably damaging Het
Jak3 A C 8: 71,684,292 K704T probably damaging Het
Kl A T 5: 150,952,996 T94S probably damaging Het
Krt73 A C 15: 101,793,859 V523G probably benign Het
Lap3 T C 5: 45,500,506 F215L probably damaging Het
Lce1c G A 3: 92,680,647 C127Y unknown Het
Mcm10 T A 2: 5,001,301 K410M probably damaging Het
Med23 T A 10: 24,904,356 N967K probably damaging Het
Mmp8 A T 9: 7,561,387 T131S probably benign Het
Ms4a14 T C 19: 11,302,031 I1054M probably benign Het
Mup14 A G 4: 61,303,888 M1T probably null Het
Myzap T A 9: 71,561,038 T110S probably benign Het
Nmrk1 A T 19: 18,642,242 K153M probably damaging Het
Nmrk1 G T 19: 18,642,243 K153N possibly damaging Het
Olfr1267-ps1 T A 2: 90,086,360 M34L probably benign Het
Olfr814 A T 10: 129,874,682 I25N probably damaging Het
Pcdh12 T C 18: 38,281,789 H761R possibly damaging Het
Pde4d C A 13: 109,116,767 L43I unknown Het
Prrc2a A T 17: 35,162,354 S46R unknown Het
Rab19 A G 6: 39,388,105 T100A probably benign Het
Rad51b C T 12: 79,300,585 R8* probably null Het
Sclt1 A T 3: 41,629,597 L642Q probably damaging Het
Scyl3 T C 1: 163,949,176 I392T possibly damaging Het
Sipa1l3 A G 7: 29,366,702 W1076R probably damaging Het
Slc12a9 C A 5: 137,322,820 A478S probably damaging Het
Slc5a9 C A 4: 111,883,916 C511F probably damaging Het
Sspo T C 6: 48,473,713 L2612P probably damaging Het
Synrg C T 11: 83,990,825 T329I probably benign Het
Tdrd9 A G 12: 112,067,637 T1338A probably benign Het
Tenm4 A T 7: 96,837,314 D996V possibly damaging Het
Ticam2 T A 18: 46,560,517 I168L probably damaging Het
Tom1l1 T C 11: 90,656,359 I374M probably benign Het
Trip10 A T 17: 57,250,966 K51I probably damaging Het
Trpc6 T A 9: 8,656,544 D735E probably benign Het
Trpm8 T A 1: 88,379,759 N1050K possibly damaging Het
Tuba8 A T 6: 121,226,021 D431V probably damaging Het
Ucn2 C T 9: 108,986,254 T28I possibly damaging Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Vmn2r8 T C 5: 108,797,656 N695S possibly damaging Het
Xirp2 A C 2: 67,525,560 N3555T possibly damaging Het
Zfp119a A T 17: 55,866,158 H228Q probably damaging Het
Zfr T A 15: 12,152,982 H566Q probably benign Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0118:Map6 UTSW 7 99317617 missense possibly damaging 0.53
R0125:Map6 UTSW 7 99335980 splice site probably null
R0244:Map6 UTSW 7 99336836 missense probably benign 0.00
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0974:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R1455:Map6 UTSW 7 99268214 missense probably damaging 1.00
R1678:Map6 UTSW 7 99268098 missense probably damaging 1.00
R1696:Map6 UTSW 7 99317457 splice site probably null
R1866:Map6 UTSW 7 99315876 missense probably damaging 1.00
R2061:Map6 UTSW 7 99317472 missense probably damaging 1.00
R3236:Map6 UTSW 7 99336824 missense probably damaging 1.00
R3625:Map6 UTSW 7 99269195 missense possibly damaging 0.60
R4044:Map6 UTSW 7 99268049 missense probably damaging 1.00
R4570:Map6 UTSW 7 99336556 missense possibly damaging 0.49
R5056:Map6 UTSW 7 99336652 missense probably benign 0.05
R5065:Map6 UTSW 7 99336710 missense probably benign 0.02
R5656:Map6 UTSW 7 99336298 missense probably damaging 1.00
R6101:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6105:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6302:Map6 UTSW 7 99336107 missense probably damaging 0.99
R6450:Map6 UTSW 7 99268038 missense probably damaging 1.00
R6915:Map6 UTSW 7 99268247 missense probably damaging 1.00
R7205:Map6 UTSW 7 99269050 missense probably benign 0.00
R7223:Map6 UTSW 7 99268025 missense probably damaging 1.00
R7293:Map6 UTSW 7 99336533 missense possibly damaging 0.49
R7481:Map6 UTSW 7 99269138 missense possibly damaging 0.57
R7691:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7693:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7695:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R8341:Map6 UTSW 7 99268440 missense possibly damaging 0.75
R8865:Map6 UTSW 7 99268985 missense probably benign 0.37
R8953:Map6 UTSW 7 99315871 missense probably damaging 1.00
R9108:Map6 UTSW 7 99336896 missense probably damaging 1.00
R9173:Map6 UTSW 7 99268728 missense probably damaging 1.00
R9613:Map6 UTSW 7 99269177 missense possibly damaging 0.90
R9654:Map6 UTSW 7 99336959 missense probably damaging 1.00
Z1176:Map6 UTSW 7 99317660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTATCTCAGCGGTACCTTG -3'
(R):5'- AGTCCTTCTGGTACTGGGTCTC -3'

Sequencing Primer
(F):5'- TCCCCGGGTGCTCTTTGAG -3'
(R):5'- TAGTCCTGTCGCATCACCGAG -3'
Posted On 2019-10-07