Incidental Mutation 'R7489:Myzap'
ID580420
Institutional Source Beutler Lab
Gene Symbol Myzap
Ensembl Gene ENSMUSG00000041361
Gene Namemyocardial zonula adherens protein
SynonymsMyozap, Grinl1a7, Gcom1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R7489 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location71504347-71592360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71561038 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 110 (T110S)
Ref Sequence ENSEMBL: ENSMUSP00000091342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093823] [ENSMUST00000163998] [ENSMUST00000164962] [ENSMUST00000165936] [ENSMUST00000166112] [ENSMUST00000166843] [ENSMUST00000169573] [ENSMUST00000171977]
Predicted Effect probably benign
Transcript: ENSMUST00000093823
AA Change: T110S

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000091342
Gene: ENSMUSG00000041361
AA Change: T110S

DomainStartEndE-ValueType
Pfam:GCOM2 96 416 1.1e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163998
AA Change: T110S

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131267
Gene: ENSMUSG00000092137
AA Change: T110S

DomainStartEndE-ValueType
coiled coil region 105 138 N/A INTRINSIC
coiled coil region 187 415 N/A INTRINSIC
coiled coil region 483 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164962
AA Change: T110S

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131353
Gene: ENSMUSG00000092137
AA Change: T110S

DomainStartEndE-ValueType
Pfam:GCOM2 96 390 7.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165936
AA Change: T110S

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127356
Gene: ENSMUSG00000092137
AA Change: T110S

DomainStartEndE-ValueType
Pfam:GCOM2 96 379 4.2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166112
Predicted Effect probably benign
Transcript: ENSMUST00000166843
AA Change: T110S

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128698
Gene: ENSMUSG00000092137
AA Change: T110S

DomainStartEndE-ValueType
Pfam:GCOM2 96 416 4.6e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169573
AA Change: T110S

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000127028
Gene: ENSMUSG00000041361
AA Change: T110S

DomainStartEndE-ValueType
Pfam:GCOM2 96 388 6.6e-68 PFAM
Predicted Effect silent
Transcript: ENSMUST00000171977
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is abundantly expressed in cardiac tissue. The encoded protein localizes to intercalated discs in cardiomyocytes and functions as an activator of Rho-dependent serum-response factor signaling. Alternative splicing results in multiple transcript variants. Readthrough transcription also exists between this gene and the neighboring downstream gene POLR2M (polymerase (RNA) II (DNA directed) polypeptide M) and is represented with GeneID: 145781. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous KO results in a maladaptive response to increased biomechanical stress, resulting in adverse cardiac remodeling, contractile dysfunction, heart failure, and increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A T 16: 88,627,234 V123D probably damaging Het
4930503E14Rik A T 14: 44,170,299 N92K probably damaging Het
4930519G04Rik T C 5: 114,879,625 S166P unknown Het
Adgrb3 G A 1: 25,547,505 T369I probably damaging Het
Agbl4 T C 4: 111,526,658 S237P probably damaging Het
Ahi1 T C 10: 20,963,750 C187R probably benign Het
Akap9 C T 5: 4,004,933 T1626M probably damaging Het
Alas1 A T 9: 106,241,634 probably null Het
Apbb1 G T 7: 105,567,480 T301N probably benign Het
Arhgap42 A G 9: 9,006,358 V679A probably benign Het
Atp2a2 T C 5: 122,467,767 D375G probably benign Het
Best1 A G 19: 9,997,046 S45P possibly damaging Het
Bpifb4 A C 2: 153,944,004 T21P probably damaging Het
Btbd11 T A 10: 85,627,215 Y615N probably damaging Het
Cdx2 A T 5: 147,306,672 M104K probably benign Het
Ces1d A T 8: 93,178,131 L327Q probably damaging Het
Ces2e A G 8: 104,929,780 H214R probably benign Het
Chd5 G A 4: 152,373,468 G1014D probably damaging Het
Cmya5 T A 13: 93,091,838 K2247N possibly damaging Het
Dip2c T C 13: 9,533,312 V110A probably damaging Het
Fam71b G C 11: 46,407,441 G524A Het
Fancd2 T C 6: 113,564,304 S724P probably benign Het
Galnt1 T A 18: 24,282,157 V485D probably damaging Het
Gli2 A G 1: 118,838,175 S749P probably benign Het
H2-M5 A C 17: 36,989,471 L12V unknown Het
Iqcf6 C A 9: 106,627,457 Q107K probably benign Het
Itfg1 C T 8: 85,767,001 C283Y probably damaging Het
Jak3 A C 8: 71,684,292 K704T probably damaging Het
Kl A T 5: 150,952,996 T94S probably damaging Het
Krt73 A C 15: 101,793,859 V523G probably benign Het
Lap3 T C 5: 45,500,506 F215L probably damaging Het
Lce1c G A 3: 92,680,647 C127Y unknown Het
Map6 C T 7: 99,268,061 R14C probably damaging Het
Mcm10 T A 2: 5,001,301 K410M probably damaging Het
Med23 T A 10: 24,904,356 N967K probably damaging Het
Mmp8 A T 9: 7,561,387 T131S probably benign Het
Ms4a14 T C 19: 11,302,031 I1054M probably benign Het
Mup14 A G 4: 61,303,888 M1T probably null Het
Nmrk1 A T 19: 18,642,242 K153M probably damaging Het
Nmrk1 G T 19: 18,642,243 K153N possibly damaging Het
Olfr1267-ps1 T A 2: 90,086,360 M34L probably benign Het
Olfr814 A T 10: 129,874,682 I25N probably damaging Het
Pcdh12 T C 18: 38,281,789 H761R possibly damaging Het
Pde4d C A 13: 109,116,767 L43I unknown Het
Prrc2a A T 17: 35,162,354 S46R unknown Het
Rab19 A G 6: 39,388,105 T100A probably benign Het
Rad51b C T 12: 79,300,585 R8* probably null Het
Sclt1 A T 3: 41,629,597 L642Q probably damaging Het
Scyl3 T C 1: 163,949,176 I392T possibly damaging Het
Sipa1l3 A G 7: 29,366,702 W1076R probably damaging Het
Slc12a9 C A 5: 137,322,820 A478S probably damaging Het
Slc5a9 C A 4: 111,883,916 C511F probably damaging Het
Sspo T C 6: 48,473,713 L2612P probably damaging Het
Synrg C T 11: 83,990,825 T329I probably benign Het
Tdrd9 A G 12: 112,067,637 T1338A probably benign Het
Tenm4 A T 7: 96,837,314 D996V possibly damaging Het
Ticam2 T A 18: 46,560,517 I168L probably damaging Het
Tom1l1 T C 11: 90,656,359 I374M probably benign Het
Trip10 A T 17: 57,250,966 K51I probably damaging Het
Trpc6 T A 9: 8,656,544 D735E probably benign Het
Trpm8 T A 1: 88,379,759 N1050K possibly damaging Het
Tuba8 A T 6: 121,226,021 D431V probably damaging Het
Ucn2 C T 9: 108,986,254 T28I possibly damaging Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Vmn2r8 T C 5: 108,797,656 N695S possibly damaging Het
Xirp2 A C 2: 67,525,560 N3555T possibly damaging Het
Zfp119a A T 17: 55,866,158 H228Q probably damaging Het
Zfr T A 15: 12,152,982 H566Q probably benign Het
Other mutations in Myzap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Myzap APN 9 71555671 missense probably benign 0.06
IGL01077:Myzap APN 9 71546760 missense probably damaging 1.00
IGL01478:Myzap APN 9 71515067 critical splice donor site probably null
IGL02146:Myzap APN 9 71564448 missense probably benign 0.43
IGL02715:Myzap APN 9 71515115 nonsense probably null
IGL03218:Myzap APN 9 71555589 missense probably benign 0.40
R0674:Myzap UTSW 9 71515144 missense probably damaging 1.00
R2298:Myzap UTSW 9 71548757 missense probably damaging 0.98
R4463:Myzap UTSW 9 71555651 missense probably benign 0.00
R4470:Myzap UTSW 9 71592281 unclassified probably benign
R4548:Myzap UTSW 9 71550246 missense possibly damaging 0.67
R4841:Myzap UTSW 9 71548755 missense probably damaging 1.00
R4842:Myzap UTSW 9 71548755 missense probably damaging 1.00
R6284:Myzap UTSW 9 71558925 missense probably benign 0.21
R6307:Myzap UTSW 9 71558864 missense possibly damaging 0.92
R7427:Myzap UTSW 9 71505183 missense probably benign 0.00
R8958:Myzap UTSW 9 71550203 missense possibly damaging 0.95
X0018:Myzap UTSW 9 71550295 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGTTGGGGTGATCTTCCTTACAT -3'
(R):5'- CGTGGGTGTCCTTCAGCTTATTG -3'

Sequencing Primer
(F):5'- AGCTAGAGGCCTAAGCTTTAAAC -3'
(R):5'- GTCCTTCAGCTTATTGTTTGGATAAC -3'
Posted On2019-10-07