Incidental Mutation 'R7489:Med23'
ID580425
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Namemediator complex subunit 23
SynonymsX83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7489 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location24869986-24913681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24904356 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 967 (N967K)
Ref Sequence ENSEMBL: ENSMUSP00000090316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]
Predicted Effect probably damaging
Transcript: ENSMUST00000020159
AA Change: N961K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: N961K

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092646
AA Change: N967K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: N967K

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176285
AA Change: N601K

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: N601K

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A T 16: 88,627,234 V123D probably damaging Het
4930503E14Rik A T 14: 44,170,299 N92K probably damaging Het
4930519G04Rik T C 5: 114,879,625 S166P unknown Het
Adgrb3 G A 1: 25,547,505 T369I probably damaging Het
Agbl4 T C 4: 111,526,658 S237P probably damaging Het
Ahi1 T C 10: 20,963,750 C187R probably benign Het
Akap9 C T 5: 4,004,933 T1626M probably damaging Het
Alas1 A T 9: 106,241,634 probably null Het
Apbb1 G T 7: 105,567,480 T301N probably benign Het
Arhgap42 A G 9: 9,006,358 V679A probably benign Het
Atp2a2 T C 5: 122,467,767 D375G probably benign Het
Best1 A G 19: 9,997,046 S45P possibly damaging Het
Bpifb4 A C 2: 153,944,004 T21P probably damaging Het
Btbd11 T A 10: 85,627,215 Y615N probably damaging Het
Cdx2 A T 5: 147,306,672 M104K probably benign Het
Ces1d A T 8: 93,178,131 L327Q probably damaging Het
Ces2e A G 8: 104,929,780 H214R probably benign Het
Chd5 G A 4: 152,373,468 G1014D probably damaging Het
Cmya5 T A 13: 93,091,838 K2247N possibly damaging Het
Dip2c T C 13: 9,533,312 V110A probably damaging Het
Fam71b G C 11: 46,407,441 G524A Het
Fancd2 T C 6: 113,564,304 S724P probably benign Het
Galnt1 T A 18: 24,282,157 V485D probably damaging Het
Gli2 A G 1: 118,838,175 S749P probably benign Het
H2-M5 A C 17: 36,989,471 L12V unknown Het
Iqcf6 C A 9: 106,627,457 Q107K probably benign Het
Itfg1 C T 8: 85,767,001 C283Y probably damaging Het
Jak3 A C 8: 71,684,292 K704T probably damaging Het
Kl A T 5: 150,952,996 T94S probably damaging Het
Krt73 A C 15: 101,793,859 V523G probably benign Het
Lap3 T C 5: 45,500,506 F215L probably damaging Het
Lce1c G A 3: 92,680,647 C127Y unknown Het
Map6 C T 7: 99,268,061 R14C probably damaging Het
Mcm10 T A 2: 5,001,301 K410M probably damaging Het
Mmp8 A T 9: 7,561,387 T131S probably benign Het
Ms4a14 T C 19: 11,302,031 I1054M probably benign Het
Mup14 A G 4: 61,303,888 M1T probably null Het
Myzap T A 9: 71,561,038 T110S probably benign Het
Nmrk1 A T 19: 18,642,242 K153M probably damaging Het
Nmrk1 G T 19: 18,642,243 K153N possibly damaging Het
Olfr1267-ps1 T A 2: 90,086,360 M34L probably benign Het
Olfr814 A T 10: 129,874,682 I25N probably damaging Het
Pcdh12 T C 18: 38,281,789 H761R possibly damaging Het
Pde4d C A 13: 109,116,767 L43I unknown Het
Prrc2a A T 17: 35,162,354 S46R unknown Het
Rab19 A G 6: 39,388,105 T100A probably benign Het
Rad51b C T 12: 79,300,585 R8* probably null Het
Sclt1 A T 3: 41,629,597 L642Q probably damaging Het
Scyl3 T C 1: 163,949,176 I392T possibly damaging Het
Sipa1l3 A G 7: 29,366,702 W1076R probably damaging Het
Slc12a9 C A 5: 137,322,820 A478S probably damaging Het
Slc5a9 C A 4: 111,883,916 C511F probably damaging Het
Sspo T C 6: 48,473,713 L2612P probably damaging Het
Synrg C T 11: 83,990,825 T329I probably benign Het
Tdrd9 A G 12: 112,067,637 T1338A probably benign Het
Tenm4 A T 7: 96,837,314 D996V possibly damaging Het
Ticam2 T A 18: 46,560,517 I168L probably damaging Het
Tom1l1 T C 11: 90,656,359 I374M probably benign Het
Trip10 A T 17: 57,250,966 K51I probably damaging Het
Trpc6 T A 9: 8,656,544 D735E probably benign Het
Trpm8 T A 1: 88,379,759 N1050K possibly damaging Het
Tuba8 A T 6: 121,226,021 D431V probably damaging Het
Ucn2 C T 9: 108,986,254 T28I possibly damaging Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Vmn2r8 T C 5: 108,797,656 N695S possibly damaging Het
Xirp2 A C 2: 67,525,560 N3555T possibly damaging Het
Zfp119a A T 17: 55,866,158 H228Q probably damaging Het
Zfr T A 15: 12,152,982 H566Q probably benign Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8182:Med23 UTSW 10 24912807 missense probably benign
R8412:Med23 UTSW 10 24908734 missense probably benign 0.01
R8874:Med23 UTSW 10 24895719 missense possibly damaging 0.92
RF003:Med23 UTSW 10 24903785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATTTAAGGAGGCATGTGC -3'
(R):5'- TTACTACATGGCGTGCTCAG -3'

Sequencing Primer
(F):5'- TGTAGATTTCTTCTTTCTCTCTCCC -3'
(R):5'- GTGCTCAGCCTATCTGTTCATAAAGG -3'
Posted On2019-10-07