Incidental Mutation 'R7489:Or6c70'
ID 580427
Institutional Source Beutler Lab
Gene Symbol Or6c70
Ensembl Gene ENSMUSG00000059134
Gene Name olfactory receptor family 6 subfamily C member 70
Synonyms MOR113-8, MOR113-5, Olfr814, GA_x6K02T2PULF-11553313-11552381
MMRRC Submission 045563-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7489 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 129709692-129710624 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 129710551 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 25 (I25N)
Ref Sequence ENSEMBL: ENSMUSP00000150716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081367] [ENSMUST00000213742] [ENSMUST00000216966]
AlphaFold Q7TRH4
Predicted Effect probably damaging
Transcript: ENSMUST00000081367
AA Change: I25N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080106
Gene: ENSMUSG00000059134
AA Change: I25N

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.2e-47 PFAM
Pfam:7tm_1 39 288 1.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213742
AA Change: I25N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216966
AA Change: I25N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A T 16: 88,424,122 (GRCm39) V123D probably damaging Het
4930503E14Rik A T 14: 44,407,756 (GRCm39) N92K probably damaging Het
4930519G04Rik T C 5: 115,017,686 (GRCm39) S166P unknown Het
Abtb3 T A 10: 85,463,079 (GRCm39) Y615N probably damaging Het
Adgrb3 G A 1: 25,586,586 (GRCm39) T369I probably damaging Het
Agbl4 T C 4: 111,383,855 (GRCm39) S237P probably damaging Het
Ahi1 T C 10: 20,839,649 (GRCm39) C187R probably benign Het
Akap9 C T 5: 4,054,933 (GRCm39) T1626M probably damaging Het
Alas1 A T 9: 106,118,833 (GRCm39) probably null Het
Apbb1 G T 7: 105,216,687 (GRCm39) T301N probably benign Het
Arhgap42 A G 9: 9,006,359 (GRCm39) V679A probably benign Het
Atp2a2 T C 5: 122,605,830 (GRCm39) D375G probably benign Het
Best1 A G 19: 9,974,410 (GRCm39) S45P possibly damaging Het
Bpifb4 A C 2: 153,785,924 (GRCm39) T21P probably damaging Het
Cdx2 A T 5: 147,243,482 (GRCm39) M104K probably benign Het
Ces1d A T 8: 93,904,759 (GRCm39) L327Q probably damaging Het
Ces2e A G 8: 105,656,412 (GRCm39) H214R probably benign Het
Chd5 G A 4: 152,457,925 (GRCm39) G1014D probably damaging Het
Cmya5 T A 13: 93,228,346 (GRCm39) K2247N possibly damaging Het
Dip2c T C 13: 9,583,348 (GRCm39) V110A probably damaging Het
Fancd2 T C 6: 113,541,265 (GRCm39) S724P probably benign Het
Galnt1 T A 18: 24,415,214 (GRCm39) V485D probably damaging Het
Garin3 G C 11: 46,298,268 (GRCm39) G524A Het
Gli2 A G 1: 118,765,905 (GRCm39) S749P probably benign Het
H2-M5 A C 17: 37,300,363 (GRCm39) L12V unknown Het
Iqcf6 C A 9: 106,504,656 (GRCm39) Q107K probably benign Het
Itfg1 C T 8: 86,493,630 (GRCm39) C283Y probably damaging Het
Jak3 A C 8: 72,136,936 (GRCm39) K704T probably damaging Het
Kl A T 5: 150,876,461 (GRCm39) T94S probably damaging Het
Krt73 A C 15: 101,702,294 (GRCm39) V523G probably benign Het
Lap3 T C 5: 45,657,848 (GRCm39) F215L probably damaging Het
Lce1c G A 3: 92,587,954 (GRCm39) C127Y unknown Het
Map6 C T 7: 98,917,268 (GRCm39) R14C probably damaging Het
Mcm10 T A 2: 5,006,112 (GRCm39) K410M probably damaging Het
Med23 T A 10: 24,780,254 (GRCm39) N967K probably damaging Het
Mmp8 A T 9: 7,561,388 (GRCm39) T131S probably benign Het
Ms4a14 T C 19: 11,279,395 (GRCm39) I1054M probably benign Het
Mup14 A G 4: 61,259,887 (GRCm39) M1T probably null Het
Myzap T A 9: 71,468,320 (GRCm39) T110S probably benign Het
Nmrk1 A T 19: 18,619,606 (GRCm39) K153M probably damaging Het
Nmrk1 G T 19: 18,619,607 (GRCm39) K153N possibly damaging Het
Or4x12-ps1 T A 2: 89,916,704 (GRCm39) M34L probably benign Het
Pcdh12 T C 18: 38,414,842 (GRCm39) H761R possibly damaging Het
Pde4d C A 13: 109,253,301 (GRCm39) L43I unknown Het
Prrc2a A T 17: 35,381,330 (GRCm39) S46R unknown Het
Rab19 A G 6: 39,365,039 (GRCm39) T100A probably benign Het
Rad51b C T 12: 79,347,359 (GRCm39) R8* probably null Het
Sclt1 A T 3: 41,584,032 (GRCm39) L642Q probably damaging Het
Scyl3 T C 1: 163,776,745 (GRCm39) I392T possibly damaging Het
Sipa1l3 A G 7: 29,066,127 (GRCm39) W1076R probably damaging Het
Slc12a9 C A 5: 137,321,082 (GRCm39) A478S probably damaging Het
Slc5a9 C A 4: 111,741,113 (GRCm39) C511F probably damaging Het
Sspo T C 6: 48,450,647 (GRCm39) L2612P probably damaging Het
Synrg C T 11: 83,881,651 (GRCm39) T329I probably benign Het
Tdrd9 A G 12: 112,034,071 (GRCm39) T1338A probably benign Het
Tenm4 A T 7: 96,486,521 (GRCm39) D996V possibly damaging Het
Ticam2 T A 18: 46,693,584 (GRCm39) I168L probably damaging Het
Tom1l1 T C 11: 90,547,185 (GRCm39) I374M probably benign Het
Trip10 A T 17: 57,557,966 (GRCm39) K51I probably damaging Het
Trpc6 T A 9: 8,656,545 (GRCm39) D735E probably benign Het
Trpm8 T A 1: 88,307,481 (GRCm39) N1050K possibly damaging Het
Tuba8 A T 6: 121,202,980 (GRCm39) D431V probably damaging Het
Ucn2 C T 9: 108,815,322 (GRCm39) T28I possibly damaging Het
Vmn1r21 C T 6: 57,820,877 (GRCm39) G189D probably damaging Het
Vmn2r8 T C 5: 108,945,522 (GRCm39) N695S possibly damaging Het
Xirp2 A C 2: 67,355,904 (GRCm39) N3555T possibly damaging Het
Zfp119a A T 17: 56,173,158 (GRCm39) H228Q probably damaging Het
Zfr T A 15: 12,153,068 (GRCm39) H566Q probably benign Het
Other mutations in Or6c70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01831:Or6c70 APN 10 129,709,900 (GRCm39) missense probably damaging 1.00
IGL02045:Or6c70 APN 10 129,710,091 (GRCm39) missense probably benign 0.22
IGL02301:Or6c70 APN 10 129,709,948 (GRCm39) missense probably damaging 0.99
R0277:Or6c70 UTSW 10 129,709,936 (GRCm39) missense probably damaging 0.99
R0281:Or6c70 UTSW 10 129,710,415 (GRCm39) missense possibly damaging 0.88
R0323:Or6c70 UTSW 10 129,709,936 (GRCm39) missense probably damaging 0.99
R0394:Or6c70 UTSW 10 129,709,811 (GRCm39) missense probably benign 0.29
R0546:Or6c70 UTSW 10 129,710,407 (GRCm39) missense possibly damaging 0.94
R3813:Or6c70 UTSW 10 129,709,855 (GRCm39) missense probably damaging 1.00
R4086:Or6c70 UTSW 10 129,710,167 (GRCm39) missense possibly damaging 0.49
R4415:Or6c70 UTSW 10 129,709,826 (GRCm39) missense probably benign 0.00
R4416:Or6c70 UTSW 10 129,709,826 (GRCm39) missense probably benign 0.00
R4453:Or6c70 UTSW 10 129,710,530 (GRCm39) missense probably null 0.30
R5194:Or6c70 UTSW 10 129,709,967 (GRCm39) missense probably benign 0.00
R5306:Or6c70 UTSW 10 129,709,810 (GRCm39) missense probably damaging 0.97
R5362:Or6c70 UTSW 10 129,710,422 (GRCm39) missense probably damaging 1.00
R5609:Or6c70 UTSW 10 129,710,607 (GRCm39) missense probably benign 0.01
R5987:Or6c70 UTSW 10 129,710,390 (GRCm39) missense probably damaging 0.98
R6240:Or6c70 UTSW 10 129,710,546 (GRCm39) missense probably benign
R6896:Or6c70 UTSW 10 129,710,623 (GRCm39) start codon destroyed probably null 0.98
R7432:Or6c70 UTSW 10 129,709,719 (GRCm39) missense probably benign
R7652:Or6c70 UTSW 10 129,710,346 (GRCm39) missense probably damaging 0.99
R8316:Or6c70 UTSW 10 129,709,891 (GRCm39) missense probably damaging 1.00
R8725:Or6c70 UTSW 10 129,710,092 (GRCm39) missense probably damaging 1.00
R8727:Or6c70 UTSW 10 129,710,092 (GRCm39) missense probably damaging 1.00
R9089:Or6c70 UTSW 10 129,710,488 (GRCm39) missense probably damaging 1.00
R9538:Or6c70 UTSW 10 129,709,762 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAATTGTCTTCTCCTGTGTTAC -3'
(R):5'- TTGAAAGGGCTGTGCTAAGG -3'

Sequencing Primer
(F):5'- GTCTTCTCCTGTGTTACAATAGTG -3'
(R):5'- GCTGTGCTAAGGAATATGGATCC -3'
Posted On 2019-10-07