Mutagenetix > Incidental Mutations

Incidental Mutation 'R7489:Dip2c'

580433

Institutional Source

Beutler Lab

Gene Symbol

Dip2c

Ensembl Gene

ENSMUSG00000048264

Gene Name

disco interacting protein 2 homolog C

Synonyms

2900024P20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.720) question?

Stock #

R7489 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

9276528-9668928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 9533312 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 110 (V110A)

Ref Sequence

ENSEMBL: ENSMUSP00000133806 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]

Predicted Effect

probably damaging
Transcript: ENSMUST00000166299
AA Change: V110A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: V110A

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	801	3.6e-23	PFAM
Pfam:AMP-binding	977	1451	1.5e-72	PFAM
low complexity region	1514	1526	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000169960
AA Change: V166A

SMART Domains

Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: V166A

Domain	Start	End	E-Value	Type
DMAP_binding	7	176	3.02e-37	SMART
low complexity region	226	243	N/A	INTRINSIC
low complexity region	331	343	N/A	INTRINSIC
Pfam:AMP-binding	380	637	5.9e-10	PFAM
SCOP:d1lci__	675	875	2e-8	SMART
Pfam:AMP-binding	947	1421	1.2e-56	PFAM
low complexity region	1484	1496	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174552
AA Change: V110A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: V110A

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	800	2.7e-20	PFAM
Pfam:AMP-binding	976	1450	1.3e-56	PFAM
low complexity region	1513	1525	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310079G19Rik	A	T	16: 88,627,234	V123D	probably damaging	Het
4930503E14Rik	A	T	14: 44,170,299	N92K	probably damaging	Het
4930519G04Rik	T	C	5: 114,879,625	S166P	unknown	Het
Adgrb3	G	A	1: 25,547,505	T369I	probably damaging	Het
Agbl4	T	C	4: 111,526,658	S237P	probably damaging	Het
Ahi1	T	C	10: 20,963,750	C187R	probably benign	Het
Akap9	C	T	5: 4,004,933	T1626M	probably damaging	Het
Alas1	A	T	9: 106,241,634		probably null	Het
Apbb1	G	T	7: 105,567,480	T301N	probably benign	Het
Arhgap42	A	G	9: 9,006,358	V679A	probably benign	Het
Atp2a2	T	C	5: 122,467,767	D375G	probably benign	Het
Best1	A	G	19: 9,997,046	S45P	possibly damaging	Het
Bpifb4	A	C	2: 153,944,004	T21P	probably damaging	Het
Btbd11	T	A	10: 85,627,215	Y615N	probably damaging	Het
Cdx2	A	T	5: 147,306,672	M104K	probably benign	Het
Ces1d	A	T	8: 93,178,131	L327Q	probably damaging	Het
Ces2e	A	G	8: 104,929,780	H214R	probably benign	Het
Chd5	G	A	4: 152,373,468	G1014D	probably damaging	Het
Cmya5	T	A	13: 93,091,838	K2247N	possibly damaging	Het
Fam71b	G	C	11: 46,407,441	G524A		Het
Fancd2	T	C	6: 113,564,304	S724P	probably benign	Het
Galnt1	T	A	18: 24,282,157	V485D	probably damaging	Het
Gli2	A	G	1: 118,838,175	S749P	probably benign	Het
H2-M5	A	C	17: 36,989,471	L12V	unknown	Het
Iqcf6	C	A	9: 106,627,457	Q107K	probably benign	Het
Itfg1	C	T	8: 85,767,001	C283Y	probably damaging	Het
Jak3	A	C	8: 71,684,292	K704T	probably damaging	Het
Kl	A	T	5: 150,952,996	T94S	probably damaging	Het
Krt73	A	C	15: 101,793,859	V523G	probably benign	Het
Lap3	T	C	5: 45,500,506	F215L	probably damaging	Het
Lce1c	G	A	3: 92,680,647	C127Y	unknown	Het
Map6	C	T	7: 99,268,061	R14C	probably damaging	Het
Mcm10	T	A	2: 5,001,301	K410M	probably damaging	Het
Med23	T	A	10: 24,904,356	N967K	probably damaging	Het
Mmp8	A	T	9: 7,561,387	T131S	probably benign	Het
Ms4a14	T	C	19: 11,302,031	I1054M	probably benign	Het
Mup14	A	G	4: 61,303,888	M1T	probably null	Het
Myzap	T	A	9: 71,561,038	T110S	probably benign	Het
Nmrk1	A	T	19: 18,642,242	K153M	probably damaging	Het
Nmrk1	G	T	19: 18,642,243	K153N	possibly damaging	Het
Olfr1267-ps1	T	A	2: 90,086,360	M34L	probably benign	Het
Olfr814	A	T	10: 129,874,682	I25N	probably damaging	Het
Pcdh12	T	C	18: 38,281,789	H761R	possibly damaging	Het
Pde4d	C	A	13: 109,116,767	L43I	unknown	Het
Prrc2a	A	T	17: 35,162,354	S46R	unknown	Het
Rab19	A	G	6: 39,388,105	T100A	probably benign	Het
Rad51b	C	T	12: 79,300,585	R8*	probably null	Het
Sclt1	A	T	3: 41,629,597	L642Q	probably damaging	Het
Scyl3	T	C	1: 163,949,176	I392T	possibly damaging	Het
Sipa1l3	A	G	7: 29,366,702	W1076R	probably damaging	Het
Slc12a9	C	A	5: 137,322,820	A478S	probably damaging	Het
Slc5a9	C	A	4: 111,883,916	C511F	probably damaging	Het
Sspo	T	C	6: 48,473,713	L2612P	probably damaging	Het
Synrg	C	T	11: 83,990,825	T329I	probably benign	Het
Tdrd9	A	G	12: 112,067,637	T1338A	probably benign	Het
Tenm4	A	T	7: 96,837,314	D996V	possibly damaging	Het
Ticam2	T	A	18: 46,560,517	I168L	probably damaging	Het
Tom1l1	T	C	11: 90,656,359	I374M	probably benign	Het
Trip10	A	T	17: 57,250,966	K51I	probably damaging	Het
Trpc6	T	A	9: 8,656,544	D735E	probably benign	Het
Trpm8	T	A	1: 88,379,759	N1050K	possibly damaging	Het
Tuba8	A	T	6: 121,226,021	D431V	probably damaging	Het
Ucn2	C	T	9: 108,986,254	T28I	possibly damaging	Het
Vmn1r21	C	T	6: 57,843,892	G189D	probably damaging	Het
Vmn2r8	T	C	5: 108,797,656	N695S	possibly damaging	Het
Xirp2	A	C	2: 67,525,560	N3555T	possibly damaging	Het
Zfp119a	A	T	17: 55,866,158	H228Q	probably damaging	Het
Zfr	T	A	15: 12,152,982	H566Q	probably benign	Het

Other mutations in Dip2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Dip2c	APN	13	9493108	missense	probably damaging	0.97
IGL00426:Dip2c	APN	13	9606515	missense	probably damaging	1.00
IGL00503:Dip2c	APN	13	9567898	missense	probably damaging	1.00
IGL00586:Dip2c	APN	13	9610755	missense	probably damaging	1.00
IGL01306:Dip2c	APN	13	9575143	missense	possibly damaging	0.72
IGL01580:Dip2c	APN	13	9637088	splice site	probably null
IGL01985:Dip2c	APN	13	9553267	splice site	probably benign
IGL02060:Dip2c	APN	13	9622630	missense	probably damaging	0.98
IGL02122:Dip2c	APN	13	9506659	missense	possibly damaging	0.48
IGL02170:Dip2c	APN	13	9606335	missense	probably benign	0.03
IGL02211:Dip2c	APN	13	9610847	missense	probably damaging	1.00
IGL02755:Dip2c	APN	13	9550320	critical splice donor site	probably null
IGL02836:Dip2c	APN	13	9610790	missense	probably damaging	0.98
IGL02935:Dip2c	APN	13	9662146	missense	probably damaging	1.00
IGL03032:Dip2c	APN	13	9551778	missense	probably damaging	1.00
ANU23:Dip2c	UTSW	13	9575143	missense	possibly damaging	0.72
P0038:Dip2c	UTSW	13	9646982	missense	probably damaging	1.00
R0009:Dip2c	UTSW	13	9621903	missense	probably damaging	1.00
R0268:Dip2c	UTSW	13	9637150	missense	probably damaging	1.00
R0271:Dip2c	UTSW	13	9615775	missense	probably damaging	1.00
R0306:Dip2c	UTSW	13	9604599	missense	probably benign	0.09
R0415:Dip2c	UTSW	13	9568289	splice site	probably benign
R0519:Dip2c	UTSW	13	9563208	missense	probably damaging	1.00
R0557:Dip2c	UTSW	13	9553459	missense	possibly damaging	0.81
R0964:Dip2c	UTSW	13	9568663	missense	probably benign	0.43
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0974:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R1101:Dip2c	UTSW	13	9634744	missense	probably damaging	1.00
R1171:Dip2c	UTSW	13	9493126	missense	possibly damaging	0.89
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1432:Dip2c	UTSW	13	9553304	missense	probably damaging	0.99
R1481:Dip2c	UTSW	13	9551866	critical splice donor site	probably null
R1588:Dip2c	UTSW	13	9665864	missense	probably damaging	1.00
R1721:Dip2c	UTSW	13	9659368	missense	probably damaging	1.00
R1726:Dip2c	UTSW	13	9575428	missense	probably damaging	1.00
R1867:Dip2c	UTSW	13	9621949	missense	possibly damaging	0.55
R1909:Dip2c	UTSW	13	9533350	missense	probably benign	0.00
R2013:Dip2c	UTSW	13	9567846	nonsense	probably null
R2022:Dip2c	UTSW	13	9551800	missense	probably damaging	1.00
R2517:Dip2c	UTSW	13	9609005	missense	probably damaging	1.00
R3746:Dip2c	UTSW	13	9601473	missense	probably damaging	1.00
R3794:Dip2c	UTSW	13	9604561	missense	probably damaging	0.99
R3884:Dip2c	UTSW	13	9551858	missense	probably damaging	1.00
R4019:Dip2c	UTSW	13	9614365	missense	probably damaging	0.99
R4110:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4111:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4113:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4256:Dip2c	UTSW	13	9609056	missense	probably damaging	1.00
R4300:Dip2c	UTSW	13	9610711	missense	probably damaging	1.00
R4494:Dip2c	UTSW	13	9571062	missense	possibly damaging	0.64
R4739:Dip2c	UTSW	13	9533339	missense	probably damaging	0.98
R4812:Dip2c	UTSW	13	9637130	nonsense	probably null
R4814:Dip2c	UTSW	13	9536860	missense	probably benign	0.07
R4816:Dip2c	UTSW	13	9575150	missense	probably benign	0.37
R4828:Dip2c	UTSW	13	9560679	missense	probably damaging	1.00
R4915:Dip2c	UTSW	13	9621869	splice site	probably null
R4917:Dip2c	UTSW	13	9621869	splice site	probably null
R4932:Dip2c	UTSW	13	9623972	missense	probably damaging	0.99
R4993:Dip2c	UTSW	13	9575223	nonsense	probably null
R5043:Dip2c	UTSW	13	9551827	missense	possibly damaging	0.80
R5349:Dip2c	UTSW	13	9622653	missense	probably damaging	1.00
R5744:Dip2c	UTSW	13	9568405	missense	probably damaging	1.00
R5840:Dip2c	UTSW	13	9506676	missense	possibly damaging	0.68
R6110:Dip2c	UTSW	13	9623766	missense	probably damaging	1.00
R6160:Dip2c	UTSW	13	9533254	missense	probably benign	0.01
R6161:Dip2c	UTSW	13	9647007	missense	probably damaging	1.00
R6477:Dip2c	UTSW	13	9623760	missense	probably damaging	1.00
R6522:Dip2c	UTSW	13	9575228	critical splice donor site	probably null
R6603:Dip2c	UTSW	13	9654588	splice site	probably null
R6658:Dip2c	UTSW	13	9493177	critical splice donor site	probably null
R6672:Dip2c	UTSW	13	9567830	critical splice acceptor site	probably null
R6697:Dip2c	UTSW	13	9621913	missense	probably damaging	1.00
R6991:Dip2c	UTSW	13	9551860	nonsense	probably null
R6991:Dip2c	UTSW	13	9634832	missense	probably damaging	1.00
R7018:Dip2c	UTSW	13	9659278	missense	probably damaging	1.00
R7053:Dip2c	UTSW	13	9610704	missense	probably damaging	1.00
R7102:Dip2c	UTSW	13	9604536	missense	probably benign	0.01
R7171:Dip2c	UTSW	13	9506648	missense	probably benign	0.34
R7371:Dip2c	UTSW	13	9592749	missense	probably benign	0.02
R7395:Dip2c	UTSW	13	9614377	missense	probably damaging	1.00
R7575:Dip2c	UTSW	13	9628012	missense	probably damaging	0.97
R7642:Dip2c	UTSW	13	9622705	critical splice donor site	probably null
R7687:Dip2c	UTSW	13	9604581	missense	probably benign	0.00
R7699:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7700:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7715:Dip2c	UTSW	13	9614391	missense	probably damaging	1.00
R7842:Dip2c	UTSW	13	9606533	critical splice donor site	probably null
R7845:Dip2c	UTSW	13	9609044	missense	probably damaging	1.00
R8354:Dip2c	UTSW	13	9621882	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GGTAGAACGACTGCTTTCCTTTAC -3'
(R):5'- TGCAAATGCTGTGATTGAAAGC -3'

Sequencing Primer
(F):5'- ACCCTTTTATTTCTGAGCTTAGGTAC -3'
(R):5'- TGCTGTGATTGAAAGCCATATTG -3'

Posted On

2019-10-07