Incidental Mutation 'R7489:Best1'
ID580447
Institutional Source Beutler Lab
Gene Symbol Best1
Ensembl Gene ENSMUSG00000037418
Gene Namebestrophin 1
Synonymsbest macular dystrophy, mBest1, Vmd2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7489 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location9985174-10001633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9997046 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 45 (S45P)
Ref Sequence ENSEMBL: ENSMUSP00000113053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117346] [ENSMUST00000121418]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117346
AA Change: S45P

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113053
Gene: ENSMUSG00000037418
AA Change: S45P

DomainStartEndE-ValueType
Pfam:Bestrophin 8 316 8.5e-111 PFAM
low complexity region 476 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121418
SMART Domains Protein: ENSMUSP00000113828
Gene: ENSMUSG00000024663

DomainStartEndE-ValueType
Pfam:Sec2p 20 129 4.3e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. Bestrophins may form chloride ion channels or may regulate voltage-gated L-type calcium-ion channels. Bestrophins are generally believed to form calcium-activated chloride-ion channels in epithelial cells but they have also been shown to be highly permeable to bicarbonate ion transport in retinal tissue. Mutations in this gene are responsible for juvenile-onset vitelliform macular dystrophy (VMD2), also known as Best macular dystrophy, in addition to adult-onset vitelliform macular dystrophy (AVMD) and other retinopathies. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous null mutations of this gene generally result in abnormal retinal pigment epithelium morphology and/or altered eye electrophysiology. Homozygotes for a null allele show male subfertility associated with abnormal sperm morphology and reduced motility in the absence of retinal pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A T 16: 88,627,234 V123D probably damaging Het
4930503E14Rik A T 14: 44,170,299 N92K probably damaging Het
4930519G04Rik T C 5: 114,879,625 S166P unknown Het
Adgrb3 G A 1: 25,547,505 T369I probably damaging Het
Agbl4 T C 4: 111,526,658 S237P probably damaging Het
Ahi1 T C 10: 20,963,750 C187R probably benign Het
Akap9 C T 5: 4,004,933 T1626M probably damaging Het
Alas1 A T 9: 106,241,634 probably null Het
Apbb1 G T 7: 105,567,480 T301N probably benign Het
Arhgap42 A G 9: 9,006,358 V679A probably benign Het
Atp2a2 T C 5: 122,467,767 D375G probably benign Het
Bpifb4 A C 2: 153,944,004 T21P probably damaging Het
Btbd11 T A 10: 85,627,215 Y615N probably damaging Het
Cdx2 A T 5: 147,306,672 M104K probably benign Het
Ces1d A T 8: 93,178,131 L327Q probably damaging Het
Ces2e A G 8: 104,929,780 H214R probably benign Het
Chd5 G A 4: 152,373,468 G1014D probably damaging Het
Cmya5 T A 13: 93,091,838 K2247N possibly damaging Het
Dip2c T C 13: 9,533,312 V110A probably damaging Het
Fam71b G C 11: 46,407,441 G524A Het
Fancd2 T C 6: 113,564,304 S724P probably benign Het
Galnt1 T A 18: 24,282,157 V485D probably damaging Het
Gli2 A G 1: 118,838,175 S749P probably benign Het
H2-M5 A C 17: 36,989,471 L12V unknown Het
Iqcf6 C A 9: 106,627,457 Q107K probably benign Het
Itfg1 C T 8: 85,767,001 C283Y probably damaging Het
Jak3 A C 8: 71,684,292 K704T probably damaging Het
Kl A T 5: 150,952,996 T94S probably damaging Het
Krt73 A C 15: 101,793,859 V523G probably benign Het
Lap3 T C 5: 45,500,506 F215L probably damaging Het
Lce1c G A 3: 92,680,647 C127Y unknown Het
Map6 C T 7: 99,268,061 R14C probably damaging Het
Mcm10 T A 2: 5,001,301 K410M probably damaging Het
Med23 T A 10: 24,904,356 N967K probably damaging Het
Mmp8 A T 9: 7,561,387 T131S probably benign Het
Ms4a14 T C 19: 11,302,031 I1054M probably benign Het
Mup14 A G 4: 61,303,888 M1T probably null Het
Myzap T A 9: 71,561,038 T110S probably benign Het
Nmrk1 A T 19: 18,642,242 K153M probably damaging Het
Nmrk1 G T 19: 18,642,243 K153N possibly damaging Het
Olfr1267-ps1 T A 2: 90,086,360 M34L probably benign Het
Olfr814 A T 10: 129,874,682 I25N probably damaging Het
Pcdh12 T C 18: 38,281,789 H761R possibly damaging Het
Pde4d C A 13: 109,116,767 L43I unknown Het
Prrc2a A T 17: 35,162,354 S46R unknown Het
Rab19 A G 6: 39,388,105 T100A probably benign Het
Rad51b C T 12: 79,300,585 R8* probably null Het
Sclt1 A T 3: 41,629,597 L642Q probably damaging Het
Scyl3 T C 1: 163,949,176 I392T possibly damaging Het
Sipa1l3 A G 7: 29,366,702 W1076R probably damaging Het
Slc12a9 C A 5: 137,322,820 A478S probably damaging Het
Slc5a9 C A 4: 111,883,916 C511F probably damaging Het
Sspo T C 6: 48,473,713 L2612P probably damaging Het
Synrg C T 11: 83,990,825 T329I probably benign Het
Tdrd9 A G 12: 112,067,637 T1338A probably benign Het
Tenm4 A T 7: 96,837,314 D996V possibly damaging Het
Ticam2 T A 18: 46,560,517 I168L probably damaging Het
Tom1l1 T C 11: 90,656,359 I374M probably benign Het
Trip10 A T 17: 57,250,966 K51I probably damaging Het
Trpc6 T A 9: 8,656,544 D735E probably benign Het
Trpm8 T A 1: 88,379,759 N1050K possibly damaging Het
Tuba8 A T 6: 121,226,021 D431V probably damaging Het
Ucn2 C T 9: 108,986,254 T28I possibly damaging Het
Vmn1r21 C T 6: 57,843,892 G189D probably damaging Het
Vmn2r8 T C 5: 108,797,656 N695S possibly damaging Het
Xirp2 A C 2: 67,525,560 N3555T possibly damaging Het
Zfp119a A T 17: 55,866,158 H228Q probably damaging Het
Zfr T A 15: 12,152,982 H566Q probably benign Het
Other mutations in Best1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Best1 APN 19 9986735 missense probably benign 0.22
IGL02129:Best1 APN 19 9992921 missense probably benign
IGL02310:Best1 APN 19 9989152 missense probably benign 0.00
IGL02470:Best1 APN 19 9992976 missense probably benign 0.43
IGL02505:Best1 APN 19 9989150 missense probably damaging 1.00
R0366:Best1 UTSW 19 9992053 splice site probably null
R1476:Best1 UTSW 19 9990489 nonsense probably null
R1674:Best1 UTSW 19 9993226 critical splice donor site probably null
R2091:Best1 UTSW 19 9992079 missense probably benign 0.27
R2516:Best1 UTSW 19 9993311 nonsense probably null
R2866:Best1 UTSW 19 9986221 missense probably benign
R4693:Best1 UTSW 19 9997135 missense probably damaging 1.00
R4851:Best1 UTSW 19 9991698 missense probably damaging 1.00
R4895:Best1 UTSW 19 9992771 missense probably benign 0.00
R5633:Best1 UTSW 19 9992103 missense probably benign 0.29
R5700:Best1 UTSW 19 9997199 unclassified probably benign
R5837:Best1 UTSW 19 9989119 splice site probably null
R6893:Best1 UTSW 19 9997082 missense probably damaging 1.00
R7021:Best1 UTSW 19 9986779 missense probably benign
R7220:Best1 UTSW 19 9992115 missense probably benign 0.31
R7267:Best1 UTSW 19 9986813 missense probably benign 0.00
R7284:Best1 UTSW 19 9986373 critical splice acceptor site probably null
R7568:Best1 UTSW 19 9989275 critical splice acceptor site probably null
R7798:Best1 UTSW 19 9991671 missense probably damaging 1.00
R8192:Best1 UTSW 19 9986300 missense possibly damaging 0.52
X0065:Best1 UTSW 19 9986975 missense probably benign 0.03
Z1177:Best1 UTSW 19 9993239 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTGCAAGACAAGCTCC -3'
(R):5'- ACTCATGCAAGTCCAAGATCAG -3'

Sequencing Primer
(F):5'- GCAAGACAAGCTCCAGGTCTTTTG -3'
(R):5'- AGATCAGAACCTAGTCTTTGACTCC -3'
Posted On2019-10-07