Incidental Mutation 'R7653:Scn9a'
ID580454
Institutional Source Beutler Lab
Gene Symbol Scn9a
Ensembl Gene ENSMUSG00000075316
Gene Namesodium channel, voltage-gated, type IX, alpha
SynonymsPN1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7653 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location66480080-66634962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66527080 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 959 (L959Q)
Ref Sequence ENSEMBL: ENSMUSP00000097642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]
Predicted Effect probably damaging
Transcript: ENSMUST00000100063
AA Change: L950Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: L950Q

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 403 9.5e-78 PFAM
coiled coil region 404 442 N/A INTRINSIC
Pfam:DUF3451 465 685 1.3e-62 PFAM
Pfam:Ion_trans 768 957 9.9e-48 PFAM
Pfam:Na_trans_assoc 972 1191 2.9e-72 PFAM
low complexity region 1203 1214 N/A INTRINSIC
Pfam:Ion_trans 1217 1445 2.8e-55 PFAM
PDB:1BYY|A 1447 1499 9e-27 PDB
Pfam:Ion_trans 1538 1748 3.4e-52 PFAM
Pfam:PKD_channel 1599 1755 1.1e-7 PFAM
IQ 1877 1899 1.03e-3 SMART
low complexity region 1956 1972 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100064
AA Change: L959Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: L959Q

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 125 412 2.2e-84 PFAM
low complexity region 433 446 N/A INTRINSIC
Pfam:Na_trans_cytopl 483 693 7.5e-76 PFAM
Pfam:Ion_trans 742 977 4.1e-57 PFAM
Pfam:Na_trans_assoc 981 1185 1.4e-58 PFAM
Pfam:Ion_trans 1189 1466 7e-67 PFAM
Pfam:Ion_trans 1512 1769 1e-55 PFAM
Pfam:PKD_channel 1605 1763 2.6e-7 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112354
AA Change: L948Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: L948Q

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.2e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164384
AA Change: L959Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: L959Q

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.1e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 694 4.2e-66 PFAM
Pfam:Ion_trans 777 966 8.8e-48 PFAM
Pfam:Na_trans_assoc 981 1200 6e-72 PFAM
low complexity region 1212 1223 N/A INTRINSIC
Pfam:Ion_trans 1226 1454 2.5e-55 PFAM
PDB:1BYY|A 1456 1508 6e-29 PDB
Pfam:Ion_trans 1547 1757 3e-52 PFAM
Pfam:PKD_channel 1608 1764 8.1e-8 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169900
AA Change: L948Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: L948Q

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 3.7e-78 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik A T 6: 92,828,069 Q70L unknown Het
Adamts12 T A 15: 11,257,029 N489K probably benign Het
Alms1 A G 6: 85,620,595 D801G possibly damaging Het
Apex1 T G 14: 50,926,538 N173K probably damaging Het
Arhgap32 A T 9: 32,257,145 N808I probably benign Het
Arhgef28 T C 13: 97,969,313 Y706C probably benign Het
Atg2b A T 12: 105,636,472 F1604Y possibly damaging Het
Atm A T 9: 53,490,302 Y1422* probably null Het
Bace2 T A 16: 97,436,652 V38E Het
BC053393 A C 11: 46,584,373 S132R probably benign Het
Birc6 C A 17: 74,647,734 L3442I possibly damaging Het
C6 T A 15: 4,814,762 S889T Het
Calcrl A T 2: 84,345,185 L275* probably null Het
Casp6 T C 3: 129,912,223 Y180H probably benign Het
Cd5 T C 19: 10,726,546 M51V probably benign Het
Cdhr1 G T 14: 37,082,201 P500Q probably benign Het
Celsr3 G A 9: 108,835,070 W1732* probably null Het
Ces2g T C 8: 104,962,653 V87A probably damaging Het
Chil6 T C 3: 106,394,325 N153S possibly damaging Het
Chrna5 A T 9: 55,002,434 D113V probably benign Het
Cox20 A G 1: 178,322,599 T113A probably benign Het
Cryl1 T C 14: 57,303,691 I179V probably benign Het
Dennd3 A G 15: 73,562,426 T982A probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
Dync2h1 A G 9: 7,117,570 S2240P probably benign Het
Fam166b T G 4: 43,427,273 probably null Het
Fbxl5 C T 5: 43,758,774 S432N probably benign Het
Fez1 T A 9: 36,860,850 S150R probably benign Het
Gabrb2 T G 11: 42,487,212 M85R probably damaging Het
Gm2035 T A 12: 87,919,478 D127V unknown Het
Lhx4 A G 1: 155,704,871 V203A probably damaging Het
Med23 G A 10: 24,904,384 D977N probably damaging Het
Mplkip T C 13: 17,695,782 F100L probably damaging Het
Ncoa7 C T 10: 30,694,243 G240E probably damaging Het
Nedd4 A G 9: 72,743,628 E827G probably damaging Het
Nfatc2 A G 2: 168,571,145 F207L probably benign Het
Nr2f1 A T 13: 78,195,597 S183T probably benign Het
Ocel1 A G 8: 71,371,916 E81G probably benign Het
Olfr1513 C A 14: 52,349,432 G205* probably null Het
Olfr432 T C 1: 174,050,922 V183A probably benign Het
Olfr733 C T 14: 50,299,147 G54E possibly damaging Het
Pcdh8 G A 14: 79,767,646 P980S probably benign Het
Pex26 A T 6: 121,193,551 Q285L possibly damaging Het
Plce1 A T 19: 38,749,319 N1603I probably benign Het
Poli A T 18: 70,509,627 C501S probably benign Het
Ppp4r4 C T 12: 103,584,145 T276I probably damaging Het
Rbpj T A 5: 53,590,351 M1K probably null Het
Recql4 T A 15: 76,703,782 M1204L probably benign Het
Ribc2 T C 15: 85,141,675 I284T probably benign Het
Rreb1 C A 13: 37,930,386 Q574K probably benign Het
Shank1 C A 7: 44,319,669 H329Q unknown Het
Soat2 A T 15: 102,162,578 D469V probably damaging Het
Spag7 T A 11: 70,664,865 H82L probably damaging Het
Sptb T C 12: 76,628,497 I248V probably benign Het
Tacr3 A G 3: 134,861,082 I239V probably benign Het
Tbc1d1 T C 5: 64,256,790 F165L probably benign Het
Tchhl1 A G 3: 93,471,144 E385G probably benign Het
Tecta C T 9: 42,337,236 D1957N probably damaging Het
Tenm2 T C 11: 36,047,347 I1501V probably benign Het
Tet2 G T 3: 133,486,385 Q763K probably benign Het
Tmem8 T A 17: 26,120,449 M579K probably damaging Het
Tox3 G A 8: 90,248,989 T338I probably damaging Het
Usp30 G A 5: 114,121,669 D479N probably damaging Het
Vmn1r27 T C 6: 58,215,800 D73G possibly damaging Het
Vmn1r27 A T 6: 58,215,894 S42T probably benign Het
Vmn2r120 A T 17: 57,509,258 V699D possibly damaging Het
Vwa2 A T 19: 56,909,335 T691S probably benign Het
Wdr31 T A 4: 62,463,429 Q55L probably benign Het
Xdh A G 17: 73,897,045 F1107L probably benign Het
Zfp184 A G 13: 21,959,717 H531R probably damaging Het
Zfp366 T C 13: 99,229,201 L290P probably damaging Het
Other mutations in Scn9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Scn9a APN 2 66563601 missense probably damaging 1.00
IGL00570:Scn9a APN 2 66484142 missense probably damaging 1.00
IGL00809:Scn9a APN 2 66483935 missense probably damaging 1.00
IGL00977:Scn9a APN 2 66484301 missense probably damaging 0.99
IGL01120:Scn9a APN 2 66526972 missense probably benign 0.00
IGL01134:Scn9a APN 2 66504968 missense probably damaging 1.00
IGL01300:Scn9a APN 2 66488053 nonsense probably null
IGL01452:Scn9a APN 2 66527072 missense probably damaging 1.00
IGL01531:Scn9a APN 2 66537378 missense probably benign 0.11
IGL01572:Scn9a APN 2 66493886 missense probably benign 0.00
IGL01645:Scn9a APN 2 66487642 missense possibly damaging 0.62
IGL01823:Scn9a APN 2 66484042 missense probably damaging 1.00
IGL01965:Scn9a APN 2 66484433 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66547135 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66494826 missense probably damaging 1.00
IGL02166:Scn9a APN 2 66493103 missense possibly damaging 0.95
IGL02183:Scn9a APN 2 66484611 splice site probably benign
IGL02640:Scn9a APN 2 66536096 critical splice donor site probably null
IGL02685:Scn9a APN 2 66537293 missense probably damaging 1.00
IGL02798:Scn9a APN 2 66540559 missense possibly damaging 0.52
IGL02832:Scn9a APN 2 66568029 missense probably damaging 1.00
IGL03008:Scn9a APN 2 66562511 missense probably damaging 1.00
IGL03270:Scn9a APN 2 66484014 missense probably damaging 1.00
IGL03408:Scn9a APN 2 66526747 missense probably benign 0.00
BB007:Scn9a UTSW 2 66504849 missense probably damaging 0.99
BB017:Scn9a UTSW 2 66504849 missense probably damaging 0.99
R0039:Scn9a UTSW 2 66562444 missense probably damaging 0.98
R0173:Scn9a UTSW 2 66533093 missense probably damaging 1.00
R0323:Scn9a UTSW 2 66568131 missense probably damaging 1.00
R0344:Scn9a UTSW 2 66505010 missense probably damaging 0.99
R0421:Scn9a UTSW 2 66543277 missense probably benign
R0465:Scn9a UTSW 2 66526996 missense probably damaging 1.00
R0514:Scn9a UTSW 2 66483678 missense probably damaging 1.00
R0599:Scn9a UTSW 2 66526799 missense probably damaging 0.96
R0627:Scn9a UTSW 2 66537377 missense probably benign 0.00
R0644:Scn9a UTSW 2 66533061 critical splice donor site probably null
R0653:Scn9a UTSW 2 66533377 missense probably damaging 1.00
R0685:Scn9a UTSW 2 66483499 missense probably benign 0.02
R0718:Scn9a UTSW 2 66547112 missense probably damaging 1.00
R0827:Scn9a UTSW 2 66536124 nonsense probably null
R0890:Scn9a UTSW 2 66483735 missense probably damaging 1.00
R1139:Scn9a UTSW 2 66504997 missense probably benign 0.02
R1385:Scn9a UTSW 2 66563542 missense probably damaging 1.00
R1398:Scn9a UTSW 2 66484586 missense probably benign 0.11
R1496:Scn9a UTSW 2 66526888 missense probably benign
R1511:Scn9a UTSW 2 66526813 missense probably benign 0.01
R1517:Scn9a UTSW 2 66505027 splice site probably benign
R1564:Scn9a UTSW 2 66484304 missense probably damaging 1.00
R1634:Scn9a UTSW 2 66488017 missense probably damaging 1.00
R1662:Scn9a UTSW 2 66483459 missense probably benign 0.00
R1695:Scn9a UTSW 2 66504876 nonsense probably null
R1709:Scn9a UTSW 2 66483506 missense probably damaging 1.00
R1741:Scn9a UTSW 2 66487594 missense probably damaging 0.99
R1755:Scn9a UTSW 2 66501716 missense probably benign 0.38
R1914:Scn9a UTSW 2 66566250 missense probably damaging 1.00
R1962:Scn9a UTSW 2 66484311 missense probably damaging 1.00
R1970:Scn9a UTSW 2 66515380 missense probably damaging 0.97
R2017:Scn9a UTSW 2 66515321 missense probably damaging 0.99
R2092:Scn9a UTSW 2 66533376 missense probably damaging 0.99
R2105:Scn9a UTSW 2 66568183 missense probably benign 0.25
R2114:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2115:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2128:Scn9a UTSW 2 66526654 missense probably damaging 1.00
R2157:Scn9a UTSW 2 66536325 missense probably damaging 1.00
R2162:Scn9a UTSW 2 66534229 missense probably damaging 0.98
R2350:Scn9a UTSW 2 66504968 missense probably damaging 1.00
R3694:Scn9a UTSW 2 66562405 missense probably benign
R3771:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3772:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3773:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3922:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R3926:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R4258:Scn9a UTSW 2 66565054 intron probably benign
R4385:Scn9a UTSW 2 66484556 missense probably damaging 1.00
R4415:Scn9a UTSW 2 66526693 missense probably damaging 1.00
R4570:Scn9a UTSW 2 66483558 missense possibly damaging 0.85
R4682:Scn9a UTSW 2 66547018 missense probably benign
R4783:Scn9a UTSW 2 66540623 missense probably benign 0.01
R4822:Scn9a UTSW 2 66483749 missense possibly damaging 0.55
R4829:Scn9a UTSW 2 66551713 missense probably benign
R4908:Scn9a UTSW 2 66526743 missense probably benign 0.03
R4983:Scn9a UTSW 2 66566270 missense probably benign 0.02
R5047:Scn9a UTSW 2 66562480 missense probably damaging 1.00
R5100:Scn9a UTSW 2 66534119 missense probably damaging 1.00
R5140:Scn9a UTSW 2 66565167 missense possibly damaging 0.81
R5398:Scn9a UTSW 2 66488043 missense probably damaging 1.00
R5557:Scn9a UTSW 2 66547103 missense probably damaging 0.99
R5582:Scn9a UTSW 2 66565029 intron probably benign
R6108:Scn9a UTSW 2 66484049 missense probably damaging 1.00
R6115:Scn9a UTSW 2 66563629 missense possibly damaging 0.70
R6143:Scn9a UTSW 2 66487524 missense probably benign 0.00
R6261:Scn9a UTSW 2 66483896 missense probably damaging 1.00
R6335:Scn9a UTSW 2 66568264 start codon destroyed possibly damaging 0.91
R6429:Scn9a UTSW 2 66526963 missense possibly damaging 0.95
R6632:Scn9a UTSW 2 66483502 missense probably benign 0.23
R6681:Scn9a UTSW 2 66563342 missense possibly damaging 0.90
R6830:Scn9a UTSW 2 66568029 missense probably damaging 1.00
R7102:Scn9a UTSW 2 66549015 missense probably damaging 1.00
R7186:Scn9a UTSW 2 66534223 missense probably damaging 1.00
R7243:Scn9a UTSW 2 66540530 missense probably damaging 1.00
R7311:Scn9a UTSW 2 66484404 missense possibly damaging 0.54
R7328:Scn9a UTSW 2 66484587 missense probably benign
R7386:Scn9a UTSW 2 66540550 missense probably damaging 1.00
R7438:Scn9a UTSW 2 66547187 missense possibly damaging 0.81
R7483:Scn9a UTSW 2 66533348 missense probably damaging 0.99
R7485:Scn9a UTSW 2 66534217 missense probably damaging 1.00
R7526:Scn9a UTSW 2 66483646 missense probably benign
R7617:Scn9a UTSW 2 66540549 missense possibly damaging 0.55
R7642:Scn9a UTSW 2 66536236 missense probably benign 0.02
R7747:Scn9a UTSW 2 66484298 missense probably damaging 1.00
R7823:Scn9a UTSW 2 66483791 missense probably damaging 1.00
R7864:Scn9a UTSW 2 66484560 missense possibly damaging 0.73
R7890:Scn9a UTSW 2 66543112 missense probably benign 0.00
R7930:Scn9a UTSW 2 66504849 missense probably damaging 0.99
R7975:Scn9a UTSW 2 66484253 missense probably damaging 1.00
R8057:Scn9a UTSW 2 66515430 missense probably benign 0.06
R8145:Scn9a UTSW 2 66487410 missense probably damaging 1.00
R8163:Scn9a UTSW 2 66484401 missense probably damaging 1.00
R8165:Scn9a UTSW 2 66540530 missense probably damaging 1.00
R8342:Scn9a UTSW 2 66536282 missense probably benign
R8345:Scn9a UTSW 2 66494622 missense probably damaging 0.96
R8464:Scn9a UTSW 2 66566281 missense probably damaging 0.99
R8467:Scn9a UTSW 2 66501671 missense probably damaging 1.00
X0003:Scn9a UTSW 2 66508647 missense probably benign 0.02
X0062:Scn9a UTSW 2 66568077 missense probably damaging 1.00
Z1176:Scn9a UTSW 2 66540592 missense probably benign 0.00
Z1177:Scn9a UTSW 2 66494685 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GATCTTTGCTTATCTCCGCAAG -3'
(R):5'- TCTGCTCTTCAGGGCAACTC -3'

Sequencing Primer
(F):5'- CGCAAGGGTACGGTTTGAG -3'
(R):5'- CAGGGCAACTCATCATGAATATTGC -3'
Posted On2019-10-07