Incidental Mutation 'R7653:Tet2'
ID580460
Institutional Source Beutler Lab
Gene Symbol Tet2
Ensembl Gene ENSMUSG00000040943
Gene Nametet methylcytosine dioxygenase 2
SynonymsE130014J05Rik, Ayu17-449
Accession Numbers

Ncbi RefSeq: NM_001040400.2; MGI:2443298

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7653 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location133463679-133545139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 133486385 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 763 (Q763K)
Ref Sequence ENSEMBL: ENSMUSP00000143029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098603] [ENSMUST00000196398] [ENSMUST00000197118]
Predicted Effect probably benign
Transcript: ENSMUST00000098603
AA Change: Q763K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096203
Gene: ENSMUSG00000040943
AA Change: Q763K

DomainStartEndE-ValueType
low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1203 1819 7e-301 SMART
low complexity region 1832 1844 N/A INTRINSIC
low complexity region 1885 1897 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196398
AA Change: Q763K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143029
Gene: ENSMUSG00000040943
AA Change: Q763K

DomainStartEndE-ValueType
low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1211 1827 3.4e-305 SMART
low complexity region 1840 1852 N/A INTRINSIC
low complexity region 1893 1905 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197118
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype Strain: 5285413; 4345275; 3813933; 5301343
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele die shortly after birth and exhibit a loss of acidic granules in the proximal convoluted tubules of the kidneys. Mice homozygous for a conditional allele activated in hematopoeitic compartment exhibit self-renewal and myeloid transforamtion. [provided by MGI curators]
Allele List at MGI

All alleles(1246) : Targeted(6) Gene trapped(1240)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik A T 6: 92,828,069 Q70L unknown Het
Adamts12 T A 15: 11,257,029 N489K probably benign Het
Alms1 A G 6: 85,620,595 D801G possibly damaging Het
Apex1 T G 14: 50,926,538 N173K probably damaging Het
Arhgap32 A T 9: 32,257,145 N808I probably benign Het
Arhgef28 T C 13: 97,969,313 Y706C probably benign Het
Atg2b A T 12: 105,636,472 F1604Y possibly damaging Het
Atm A T 9: 53,490,302 Y1422* probably null Het
Bace2 T A 16: 97,436,652 V38E Het
BC053393 A C 11: 46,584,373 S132R probably benign Het
Birc6 C A 17: 74,647,734 L3442I possibly damaging Het
C6 T A 15: 4,814,762 S889T Het
Calcrl A T 2: 84,345,185 L275* probably null Het
Casp6 T C 3: 129,912,223 Y180H probably benign Het
Cd5 T C 19: 10,726,546 M51V probably benign Het
Cdhr1 G T 14: 37,082,201 P500Q probably benign Het
Celsr3 G A 9: 108,835,070 W1732* probably null Het
Ces2g T C 8: 104,962,653 V87A probably damaging Het
Chil6 T C 3: 106,394,325 N153S possibly damaging Het
Chrna5 A T 9: 55,002,434 D113V probably benign Het
Cox20 A G 1: 178,322,599 T113A probably benign Het
Cryl1 T C 14: 57,303,691 I179V probably benign Het
Dennd3 A G 15: 73,562,426 T982A probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
Dync2h1 A G 9: 7,117,570 S2240P probably benign Het
Fam166b T G 4: 43,427,273 probably null Het
Fbxl5 C T 5: 43,758,774 S432N probably benign Het
Fez1 T A 9: 36,860,850 S150R probably benign Het
Gabrb2 T G 11: 42,487,212 M85R probably damaging Het
Gm2035 T A 12: 87,919,478 D127V unknown Het
Lhx4 A G 1: 155,704,871 V203A probably damaging Het
Med23 G A 10: 24,904,384 D977N probably damaging Het
Mplkip T C 13: 17,695,782 F100L probably damaging Het
Ncoa7 C T 10: 30,694,243 G240E probably damaging Het
Nedd4 A G 9: 72,743,628 E827G probably damaging Het
Nfatc2 A G 2: 168,571,145 F207L probably benign Het
Nr2f1 A T 13: 78,195,597 S183T probably benign Het
Ocel1 A G 8: 71,371,916 E81G probably benign Het
Olfr1513 C A 14: 52,349,432 G205* probably null Het
Olfr432 T C 1: 174,050,922 V183A probably benign Het
Olfr733 C T 14: 50,299,147 G54E possibly damaging Het
Pcdh8 G A 14: 79,767,646 P980S probably benign Het
Pex26 A T 6: 121,193,551 Q285L possibly damaging Het
Plce1 A T 19: 38,749,319 N1603I probably benign Het
Poli A T 18: 70,509,627 C501S probably benign Het
Ppp4r4 C T 12: 103,584,145 T276I probably damaging Het
Rbpj T A 5: 53,590,351 M1K probably null Het
Recql4 T A 15: 76,703,782 M1204L probably benign Het
Ribc2 T C 15: 85,141,675 I284T probably benign Het
Rreb1 C A 13: 37,930,386 Q574K probably benign Het
Scn9a A T 2: 66,527,080 L959Q probably damaging Het
Shank1 C A 7: 44,319,669 H329Q unknown Het
Soat2 A T 15: 102,162,578 D469V probably damaging Het
Spag7 T A 11: 70,664,865 H82L probably damaging Het
Sptb T C 12: 76,628,497 I248V probably benign Het
Tacr3 A G 3: 134,861,082 I239V probably benign Het
Tbc1d1 T C 5: 64,256,790 F165L probably benign Het
Tchhl1 A G 3: 93,471,144 E385G probably benign Het
Tecta C T 9: 42,337,236 D1957N probably damaging Het
Tenm2 T C 11: 36,047,347 I1501V probably benign Het
Tmem8 T A 17: 26,120,449 M579K probably damaging Het
Tox3 G A 8: 90,248,989 T338I probably damaging Het
Usp30 G A 5: 114,121,669 D479N probably damaging Het
Vmn1r27 T C 6: 58,215,800 D73G possibly damaging Het
Vmn1r27 A T 6: 58,215,894 S42T probably benign Het
Vmn2r120 A T 17: 57,509,258 V699D possibly damaging Het
Vwa2 A T 19: 56,909,335 T691S probably benign Het
Wdr31 T A 4: 62,463,429 Q55L probably benign Het
Xdh A G 17: 73,897,045 F1107L probably benign Het
Zfp184 A G 13: 21,959,717 H531R probably damaging Het
Zfp366 T C 13: 99,229,201 L290P probably damaging Het
Other mutations in Tet2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Tet2 APN 3 133488085 missense possibly damaging 0.96
IGL00401:Tet2 APN 3 133466882 missense possibly damaging 0.72
IGL01528:Tet2 APN 3 133480298 missense possibly damaging 0.86
IGL02053:Tet2 APN 3 133488523 missense possibly damaging 0.96
IGL02142:Tet2 APN 3 133480139 missense possibly damaging 0.96
IGL02512:Tet2 APN 3 133469308 missense probably benign 0.05
IGL03148:Tet2 APN 3 133481363 missense probably benign 0.18
IGL03182:Tet2 APN 3 133471398 nonsense probably null
IGL03371:Tet2 APN 3 133467551 missense possibly damaging 0.71
P0022:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0023:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0031:Tet2 UTSW 3 133480202 missense possibly damaging 0.53
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0463:Tet2 UTSW 3 133486666 missense possibly damaging 0.86
R0522:Tet2 UTSW 3 133466804 missense probably damaging 0.98
R0593:Tet2 UTSW 3 133488109 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467602 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467725 missense probably benign 0.01
R0698:Tet2 UTSW 3 133467384 missense probably benign 0.32
R0723:Tet2 UTSW 3 133467284 missense probably benign
R0726:Tet2 UTSW 3 133468184 missense probably benign
R0747:Tet2 UTSW 3 133467470 missense possibly damaging 0.86
R1006:Tet2 UTSW 3 133476601 missense possibly damaging 0.53
R1382:Tet2 UTSW 3 133476615 missense probably damaging 1.00
R1455:Tet2 UTSW 3 133473645 missense possibly damaging 0.51
R1550:Tet2 UTSW 3 133469519 missense probably benign 0.32
R1647:Tet2 UTSW 3 133485880 missense probably benign
R1662:Tet2 UTSW 3 133466852 missense possibly damaging 0.96
R1727:Tet2 UTSW 3 133487290 missense probably damaging 0.98
R1738:Tet2 UTSW 3 133481387 missense probably benign 0.08
R1749:Tet2 UTSW 3 133480131 critical splice donor site probably null
R1869:Tet2 UTSW 3 133481441 splice site probably null
R1887:Tet2 UTSW 3 133487333 missense possibly damaging 0.68
R1937:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1939:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1940:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1997:Tet2 UTSW 3 133486589 nonsense probably null
R2082:Tet2 UTSW 3 133485727 missense possibly damaging 0.96
R2084:Tet2 UTSW 3 133487767 missense possibly damaging 0.68
R2215:Tet2 UTSW 3 133486601 missense probably benign 0.03
R2321:Tet2 UTSW 3 133486339 missense possibly damaging 0.53
R2873:Tet2 UTSW 3 133486954 missense probably damaging 1.00
R3439:Tet2 UTSW 3 133466831 missense possibly damaging 0.93
R3783:Tet2 UTSW 3 133479363 missense possibly damaging 0.53
R3894:Tet2 UTSW 3 133469477 missense possibly damaging 0.86
R3916:Tet2 UTSW 3 133486055 missense possibly damaging 0.53
R3966:Tet2 UTSW 3 133487657 missense possibly damaging 0.73
R4457:Tet2 UTSW 3 133485563 missense possibly damaging 0.85
R4633:Tet2 UTSW 3 133485549 missense probably benign 0.33
R4646:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4647:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4648:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4691:Tet2 UTSW 3 133486083 missense possibly damaging 0.73
R4805:Tet2 UTSW 3 133467315 missense probably benign 0.32
R4829:Tet2 UTSW 3 133476620 missense possibly damaging 0.91
R4901:Tet2 UTSW 3 133467044 missense possibly damaging 0.86
R4975:Tet2 UTSW 3 133486759 unclassified probably benign
R5004:Tet2 UTSW 3 133487379 missense possibly damaging 0.84
R5075:Tet2 UTSW 3 133486906 missense probably benign
R5137:Tet2 UTSW 3 133476565 missense probably benign 0.32
R5324:Tet2 UTSW 3 133485913 missense probably benign 0.00
R5590:Tet2 UTSW 3 133476480 splice site probably null
R5854:Tet2 UTSW 3 133487885 missense probably damaging 0.98
R5856:Tet2 UTSW 3 133486640 missense probably benign 0.01
R5865:Tet2 UTSW 3 133487099 missense probably benign 0.08
R5879:Tet2 UTSW 3 133487960 missense possibly damaging 0.96
R5935:Tet2 UTSW 3 133488535 missense possibly damaging 0.68
R6012:Tet2 UTSW 3 133466781 missense possibly damaging 0.86
R6075:Tet2 UTSW 3 133471435 missense possibly damaging 0.71
R6181:Tet2 UTSW 3 133487759 nonsense probably null
R6188:Tet2 UTSW 3 133480326 missense probably benign 0.18
R6339:Tet2 UTSW 3 133486417 missense possibly damaging 0.53
R6612:Tet2 UTSW 3 133487335 missense possibly damaging 0.53
R6923:Tet2 UTSW 3 133479341 critical splice donor site probably null
R6934:Tet2 UTSW 3 133483237 critical splice donor site probably null
R7076:Tet2 UTSW 3 133467023 missense possibly damaging 0.71
R7155:Tet2 UTSW 3 133469591 missense possibly damaging 0.71
R7184:Tet2 UTSW 3 133473630 missense probably damaging 0.98
R7200:Tet2 UTSW 3 133487192 missense probably benign 0.18
R7459:Tet2 UTSW 3 133480289 missense possibly damaging 0.53
R7504:Tet2 UTSW 3 133487339 missense probably benign 0.33
R7524:Tet2 UTSW 3 133480229 missense probably benign 0.33
R7613:Tet2 UTSW 3 133466748 missense possibly damaging 0.83
R7691:Tet2 UTSW 3 133486849 missense probably damaging 0.98
X0021:Tet2 UTSW 3 133486295 missense possibly damaging 0.85
X0066:Tet2 UTSW 3 133488373 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAGCTTGCTGAGGCTTCTGC -3'
(R):5'- GAGCAAATGCCTCAGACTTTC -3'

Sequencing Primer
(F):5'- TTGTTCCTGAAAGCACCGG -3'
(R):5'- CTCTCATCTCCAAGGTAGCAATG -3'
Posted On2019-10-07