Incidental Mutation 'R7653:Tox3'
ID580475
Institutional Source Beutler Lab
Gene Symbol Tox3
Ensembl Gene ENSMUSG00000043668
Gene NameTOX high mobility group box family member 3
SynonymsCAGF9, Tnrc9, 500-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.872) question?
Stock #R7653 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location90247040-90348343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90248989 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 338 (T338I)
Ref Sequence ENSEMBL: ENSMUSP00000105250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109621] [ENSMUST00000176616]
Predicted Effect probably damaging
Transcript: ENSMUST00000109621
AA Change: T338I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105250
Gene: ENSMUSG00000043668
AA Change: T338I

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 195 214 N/A INTRINSIC
HMG 253 323 2.93e-19 SMART
low complexity region 345 362 N/A INTRINSIC
coiled coil region 438 466 N/A INTRINSIC
low complexity region 548 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176616
SMART Domains Protein: ENSMUSP00000135697
Gene: ENSMUSG00000043668

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 194 213 N/A INTRINSIC
HMG 252 309 1.29e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an HMG-box, indicating that it may be involved in bending and unwinding of DNA and alteration of chromatin structure. The C-terminus of the encoded protein is glutamine-rich due to CAG repeats in the coding sequence. A minor allele of this gene has been implicated in an elevated risk of breast cancer. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik A T 6: 92,828,069 Q70L unknown Het
Adamts12 T A 15: 11,257,029 N489K probably benign Het
Alms1 A G 6: 85,620,595 D801G possibly damaging Het
Apex1 T G 14: 50,926,538 N173K probably damaging Het
Arhgap32 A T 9: 32,257,145 N808I probably benign Het
Arhgef28 T C 13: 97,969,313 Y706C probably benign Het
Atg2b A T 12: 105,636,472 F1604Y possibly damaging Het
Atm A T 9: 53,490,302 Y1422* probably null Het
Bace2 T A 16: 97,436,652 V38E Het
BC053393 A C 11: 46,584,373 S132R probably benign Het
Birc6 C A 17: 74,647,734 L3442I possibly damaging Het
C6 T A 15: 4,814,762 S889T Het
Calcrl A T 2: 84,345,185 L275* probably null Het
Casp6 T C 3: 129,912,223 Y180H probably benign Het
Cd5 T C 19: 10,726,546 M51V probably benign Het
Cdhr1 G T 14: 37,082,201 P500Q probably benign Het
Celsr3 G A 9: 108,835,070 W1732* probably null Het
Ces2g T C 8: 104,962,653 V87A probably damaging Het
Chil6 T C 3: 106,394,325 N153S possibly damaging Het
Chrna5 A T 9: 55,002,434 D113V probably benign Het
Cox20 A G 1: 178,322,599 T113A probably benign Het
Cryl1 T C 14: 57,303,691 I179V probably benign Het
Dennd3 A G 15: 73,562,426 T982A probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
Dync2h1 A G 9: 7,117,570 S2240P probably benign Het
Fam166b T G 4: 43,427,273 probably null Het
Fbxl5 C T 5: 43,758,774 S432N probably benign Het
Fez1 T A 9: 36,860,850 S150R probably benign Het
Gabrb2 T G 11: 42,487,212 M85R probably damaging Het
Gm2035 T A 12: 87,919,478 D127V unknown Het
Lhx4 A G 1: 155,704,871 V203A probably damaging Het
Med23 G A 10: 24,904,384 D977N probably damaging Het
Mplkip T C 13: 17,695,782 F100L probably damaging Het
Ncoa7 C T 10: 30,694,243 G240E probably damaging Het
Nedd4 A G 9: 72,743,628 E827G probably damaging Het
Nfatc2 A G 2: 168,571,145 F207L probably benign Het
Nr2f1 A T 13: 78,195,597 S183T probably benign Het
Ocel1 A G 8: 71,371,916 E81G probably benign Het
Olfr1513 C A 14: 52,349,432 G205* probably null Het
Olfr432 T C 1: 174,050,922 V183A probably benign Het
Olfr733 C T 14: 50,299,147 G54E possibly damaging Het
Pcdh8 G A 14: 79,767,646 P980S probably benign Het
Pex26 A T 6: 121,193,551 Q285L possibly damaging Het
Plce1 A T 19: 38,749,319 N1603I probably benign Het
Poli A T 18: 70,509,627 C501S probably benign Het
Ppp4r4 C T 12: 103,584,145 T276I probably damaging Het
Rbpj T A 5: 53,590,351 M1K probably null Het
Recql4 T A 15: 76,703,782 M1204L probably benign Het
Ribc2 T C 15: 85,141,675 I284T probably benign Het
Rreb1 C A 13: 37,930,386 Q574K probably benign Het
Scn9a A T 2: 66,527,080 L959Q probably damaging Het
Shank1 C A 7: 44,319,669 H329Q unknown Het
Soat2 A T 15: 102,162,578 D469V probably damaging Het
Spag7 T A 11: 70,664,865 H82L probably damaging Het
Sptb T C 12: 76,628,497 I248V probably benign Het
Tacr3 A G 3: 134,861,082 I239V probably benign Het
Tbc1d1 T C 5: 64,256,790 F165L probably benign Het
Tchhl1 A G 3: 93,471,144 E385G probably benign Het
Tecta C T 9: 42,337,236 D1957N probably damaging Het
Tenm2 T C 11: 36,047,347 I1501V probably benign Het
Tet2 G T 3: 133,486,385 Q763K probably benign Het
Tmem8 T A 17: 26,120,449 M579K probably damaging Het
Usp30 G A 5: 114,121,669 D479N probably damaging Het
Vmn1r27 T C 6: 58,215,800 D73G possibly damaging Het
Vmn1r27 A T 6: 58,215,894 S42T probably benign Het
Vmn2r120 A T 17: 57,509,258 V699D possibly damaging Het
Vwa2 A T 19: 56,909,335 T691S probably benign Het
Wdr31 T A 4: 62,463,429 Q55L probably benign Het
Xdh A G 17: 73,897,045 F1107L probably benign Het
Zfp184 A G 13: 21,959,717 H531R probably damaging Het
Zfp366 T C 13: 99,229,201 L290P probably damaging Het
Other mutations in Tox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Tox3 APN 8 90270434 missense probably damaging 1.00
IGL02417:Tox3 APN 8 90258131 missense possibly damaging 0.52
IGL02447:Tox3 APN 8 90258153 splice site probably benign
R1139:Tox3 UTSW 8 90248869 missense probably damaging 1.00
R1472:Tox3 UTSW 8 90254345 missense probably damaging 1.00
R1892:Tox3 UTSW 8 90270241 missense probably benign 0.31
R1906:Tox3 UTSW 8 90248429 unclassified probably benign
R2847:Tox3 UTSW 8 90248390 nonsense probably null
R2849:Tox3 UTSW 8 90248390 nonsense probably null
R3703:Tox3 UTSW 8 90248905 missense possibly damaging 0.52
R3705:Tox3 UTSW 8 90248905 missense possibly damaging 0.52
R4984:Tox3 UTSW 8 90248642 unclassified probably benign
R5249:Tox3 UTSW 8 90248816 missense probably benign 0.09
R5722:Tox3 UTSW 8 90347861 critical splice donor site probably null
R6291:Tox3 UTSW 8 90248938 missense probably damaging 1.00
R6451:Tox3 UTSW 8 90258059 missense probably benign 0.31
R7753:Tox3 UTSW 8 90248932 missense probably damaging 1.00
R8220:Tox3 UTSW 8 90258080 missense probably damaging 0.97
R8337:Tox3 UTSW 8 90347879 missense probably damaging 0.99
R8387:Tox3 UTSW 8 90257967 missense probably benign
R8525:Tox3 UTSW 8 90274681
Predicted Primers PCR Primer
(F):5'- GAACTTATCAGTGGAGCCCC -3'
(R):5'- CCCACCTTCAGGAAGTGTTTC -3'

Sequencing Primer
(F):5'- CAATGGTGACTGATGTGACGATC -3'
(R):5'- CACCTTCAGGAAGTGTTTCGACAG -3'
Posted On2019-10-07