Incidental Mutation 'R7653:Atm'
ID580481
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Nameataxia telangiectasia mutated
SynonymsC030026E19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock #R7653 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location53439149-53536740 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 53490302 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1422 (Y1422*)
Ref Sequence ENSEMBL: ENSMUSP00000113388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]
Predicted Effect probably null
Transcript: ENSMUST00000118282
AA Change: Y1422*
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: Y1422*

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000232179
AA Change: Y1422*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik A T 6: 92,828,069 Q70L unknown Het
Adamts12 T A 15: 11,257,029 N489K probably benign Het
Alms1 A G 6: 85,620,595 D801G possibly damaging Het
Apex1 T G 14: 50,926,538 N173K probably damaging Het
Arhgap32 A T 9: 32,257,145 N808I probably benign Het
Arhgef28 T C 13: 97,969,313 Y706C probably benign Het
Atg2b A T 12: 105,636,472 F1604Y possibly damaging Het
Bace2 T A 16: 97,436,652 V38E Het
BC053393 A C 11: 46,584,373 S132R probably benign Het
Birc6 C A 17: 74,647,734 L3442I possibly damaging Het
C6 T A 15: 4,814,762 S889T Het
Calcrl A T 2: 84,345,185 L275* probably null Het
Casp6 T C 3: 129,912,223 Y180H probably benign Het
Cd5 T C 19: 10,726,546 M51V probably benign Het
Cdhr1 G T 14: 37,082,201 P500Q probably benign Het
Celsr3 G A 9: 108,835,070 W1732* probably null Het
Ces2g T C 8: 104,962,653 V87A probably damaging Het
Chil6 T C 3: 106,394,325 N153S possibly damaging Het
Chrna5 A T 9: 55,002,434 D113V probably benign Het
Cox20 A G 1: 178,322,599 T113A probably benign Het
Cryl1 T C 14: 57,303,691 I179V probably benign Het
Dennd3 A G 15: 73,562,426 T982A probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
Dync2h1 A G 9: 7,117,570 S2240P probably benign Het
Fam166b T G 4: 43,427,273 probably null Het
Fbxl5 C T 5: 43,758,774 S432N probably benign Het
Fez1 T A 9: 36,860,850 S150R probably benign Het
Gabrb2 T G 11: 42,487,212 M85R probably damaging Het
Gm2035 T A 12: 87,919,478 D127V unknown Het
Lhx4 A G 1: 155,704,871 V203A probably damaging Het
Med23 G A 10: 24,904,384 D977N probably damaging Het
Mplkip T C 13: 17,695,782 F100L probably damaging Het
Ncoa7 C T 10: 30,694,243 G240E probably damaging Het
Nedd4 A G 9: 72,743,628 E827G probably damaging Het
Nfatc2 A G 2: 168,571,145 F207L probably benign Het
Nr2f1 A T 13: 78,195,597 S183T probably benign Het
Ocel1 A G 8: 71,371,916 E81G probably benign Het
Olfr1513 C A 14: 52,349,432 G205* probably null Het
Olfr432 T C 1: 174,050,922 V183A probably benign Het
Olfr733 C T 14: 50,299,147 G54E possibly damaging Het
Pcdh8 G A 14: 79,767,646 P980S probably benign Het
Pex26 A T 6: 121,193,551 Q285L possibly damaging Het
Plce1 A T 19: 38,749,319 N1603I probably benign Het
Poli A T 18: 70,509,627 C501S probably benign Het
Ppp4r4 C T 12: 103,584,145 T276I probably damaging Het
Rbpj T A 5: 53,590,351 M1K probably null Het
Recql4 T A 15: 76,703,782 M1204L probably benign Het
Ribc2 T C 15: 85,141,675 I284T probably benign Het
Rreb1 C A 13: 37,930,386 Q574K probably benign Het
Scn9a A T 2: 66,527,080 L959Q probably damaging Het
Shank1 C A 7: 44,319,669 H329Q unknown Het
Soat2 A T 15: 102,162,578 D469V probably damaging Het
Spag7 T A 11: 70,664,865 H82L probably damaging Het
Sptb T C 12: 76,628,497 I248V probably benign Het
Tacr3 A G 3: 134,861,082 I239V probably benign Het
Tbc1d1 T C 5: 64,256,790 F165L probably benign Het
Tchhl1 A G 3: 93,471,144 E385G probably benign Het
Tecta C T 9: 42,337,236 D1957N probably damaging Het
Tenm2 T C 11: 36,047,347 I1501V probably benign Het
Tet2 G T 3: 133,486,385 Q763K probably benign Het
Tmem8 T A 17: 26,120,449 M579K probably damaging Het
Tox3 G A 8: 90,248,989 T338I probably damaging Het
Usp30 G A 5: 114,121,669 D479N probably damaging Het
Vmn1r27 T C 6: 58,215,800 D73G possibly damaging Het
Vmn1r27 A T 6: 58,215,894 S42T probably benign Het
Vmn2r120 A T 17: 57,509,258 V699D possibly damaging Het
Vwa2 A T 19: 56,909,335 T691S probably benign Het
Wdr31 T A 4: 62,463,429 Q55L probably benign Het
Xdh A G 17: 73,897,045 F1107L probably benign Het
Zfp184 A G 13: 21,959,717 H531R probably damaging Het
Zfp366 T C 13: 99,229,201 L290P probably damaging Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53524443 missense probably damaging 1.00
IGL00466:Atm APN 9 53499112 splice site probably benign
IGL00567:Atm APN 9 53503116 nonsense probably null
IGL00702:Atm APN 9 53511831 missense probably benign 0.02
IGL00743:Atm APN 9 53513116 missense probably benign 0.00
IGL00771:Atm APN 9 53493054 missense probably benign 0.01
IGL00773:Atm APN 9 53522144 missense probably benign 0.00
IGL00819:Atm APN 9 53518531 missense probably damaging 1.00
IGL00864:Atm APN 9 53533933 missense probably damaging 0.99
IGL00985:Atm APN 9 53459816 missense probably damaging 0.98
IGL01109:Atm APN 9 53490293 missense probably damaging 1.00
IGL01120:Atm APN 9 53461122 critical splice acceptor site probably null
IGL01369:Atm APN 9 53515317 missense probably benign
IGL01374:Atm APN 9 53531724 missense possibly damaging 0.58
IGL01406:Atm APN 9 53439746 makesense probably null
IGL01409:Atm APN 9 53499171 missense probably benign 0.01
IGL01434:Atm APN 9 53507807 missense probably benign 0.04
IGL01486:Atm APN 9 53510213 missense probably benign
IGL01583:Atm APN 9 53484247 splice site probably benign
IGL01861:Atm APN 9 53494612 missense probably null 0.89
IGL01865:Atm APN 9 53461002 missense probably damaging 1.00
IGL02026:Atm APN 9 53442417 splice site probably null
IGL02072:Atm APN 9 53459796 missense probably benign 0.01
IGL02075:Atm APN 9 53527237 missense probably damaging 1.00
IGL02127:Atm APN 9 53487983 missense probably damaging 1.00
IGL02175:Atm APN 9 53480665 missense probably damaging 0.99
IGL02246:Atm APN 9 53527185 missense probably benign 0.12
IGL02259:Atm APN 9 53518494 splice site probably benign
IGL02351:Atm APN 9 53522176 missense probably benign 0.04
IGL02358:Atm APN 9 53522176 missense probably benign 0.04
IGL02387:Atm APN 9 53479766 splice site probably null
IGL02417:Atm APN 9 53479695 missense probably benign 0.00
IGL02422:Atm APN 9 53500792 missense probably damaging 1.00
IGL02445:Atm APN 9 53454330 missense probably benign 0.00
IGL02492:Atm APN 9 53455859 missense probably damaging 0.99
IGL02513:Atm APN 9 53497262 splice site probably benign
IGL02633:Atm APN 9 53448153 missense probably damaging 1.00
IGL02634:Atm APN 9 53516563 missense probably benign 0.00
IGL02948:Atm APN 9 53453440 splice site probably benign
IGL02959:Atm APN 9 53471418 missense probably damaging 1.00
IGL02965:Atm APN 9 53453563 missense probably damaging 1.00
IGL03085:Atm APN 9 53484171 missense possibly damaging 0.89
antebellum UTSW 9 53518559 nonsense probably null
bull_run UTSW 9 53487922 missense probably benign 0.09
Civil UTSW 9 53492268 missense possibly damaging 0.78
gettysburg UTSW 9 53455988 splice site probably null
Grant UTSW 9 53511917 nonsense probably null
mockingbird UTSW 9 53516467 nonsense probably null
mockingbird2 UTSW 9 53488587 missense probably damaging 1.00
osphere UTSW 9 53479673 missense probably damaging 0.99
shiloh UTSW 9 53465298 missense probably damaging 1.00
Strato UTSW 9 53503018 missense probably damaging 1.00
thrasher UTSW 9 53445507 missense probably benign 0.01
Tropo UTSW 9 53531648 missense probably damaging 1.00
P0019:Atm UTSW 9 53465028 splice site probably benign
PIT4403001:Atm UTSW 9 53500982 missense probably benign
PIT4687001:Atm UTSW 9 53486812 critical splice donor site probably null
R0004:Atm UTSW 9 53453528 splice site probably benign
R0035:Atm UTSW 9 53513180 missense probably benign 0.01
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0201:Atm UTSW 9 53454279 splice site probably benign
R0304:Atm UTSW 9 53516344 missense probably benign 0.34
R0308:Atm UTSW 9 53454473 splice site probably null
R0362:Atm UTSW 9 53458838 missense possibly damaging 0.90
R0470:Atm UTSW 9 53460966 missense probably damaging 1.00
R0513:Atm UTSW 9 53503948 missense probably benign 0.00
R0589:Atm UTSW 9 53490192 missense possibly damaging 0.51
R0617:Atm UTSW 9 53458941 nonsense probably null
R0630:Atm UTSW 9 53531622 splice site probably benign
R0652:Atm UTSW 9 53486014 missense probably damaging 0.98
R0698:Atm UTSW 9 53515239 missense probably damaging 1.00
R0737:Atm UTSW 9 53456566 missense probably damaging 1.00
R0885:Atm UTSW 9 53459823 missense probably benign
R0947:Atm UTSW 9 53504092 missense probably benign 0.01
R0948:Atm UTSW 9 53495958 missense probably benign
R1144:Atm UTSW 9 53511698 splice site probably benign
R1252:Atm UTSW 9 53455840 missense probably damaging 1.00
R1295:Atm UTSW 9 53456530 missense probably damaging 1.00
R1296:Atm UTSW 9 53456530 missense probably damaging 1.00
R1419:Atm UTSW 9 53457489 missense probably benign 0.00
R1477:Atm UTSW 9 53464273 missense probably benign 0.00
R1596:Atm UTSW 9 53453378 missense probably damaging 1.00
R1630:Atm UTSW 9 53479673 missense probably damaging 0.99
R1667:Atm UTSW 9 53500932 missense probably damaging 1.00
R1681:Atm UTSW 9 53522155 missense possibly damaging 0.94
R1703:Atm UTSW 9 53500700 missense probably benign
R1817:Atm UTSW 9 53492233 splice site probably benign
R1840:Atm UTSW 9 53456530 missense probably damaging 1.00
R1848:Atm UTSW 9 53468012 missense probably benign 0.06
R1906:Atm UTSW 9 53506568 missense probably damaging 1.00
R1958:Atm UTSW 9 53471418 missense probably damaging 1.00
R2108:Atm UTSW 9 53443997 missense probably damaging 1.00
R2116:Atm UTSW 9 53500969 missense probably benign 0.36
R2134:Atm UTSW 9 53467964 critical splice donor site probably null
R2137:Atm UTSW 9 53453375 missense probably damaging 1.00
R2291:Atm UTSW 9 53490909 splice site probably null
R2348:Atm UTSW 9 53492268 missense possibly damaging 0.78
R2483:Atm UTSW 9 53510266 missense probably damaging 1.00
R2567:Atm UTSW 9 53457470 missense possibly damaging 0.72
R2897:Atm UTSW 9 53507805 missense probably damaging 0.99
R2939:Atm UTSW 9 53494711 missense probably damaging 1.00
R3008:Atm UTSW 9 53480750 missense probably benign 0.00
R3236:Atm UTSW 9 53479748 missense probably benign 0.15
R3847:Atm UTSW 9 53503075 missense possibly damaging 0.94
R3889:Atm UTSW 9 53506636 splice site probably benign
R3919:Atm UTSW 9 53492278 missense probably benign 0.00
R4125:Atm UTSW 9 53450621 missense probably damaging 1.00
R4222:Atm UTSW 9 53480669 missense probably benign
R4395:Atm UTSW 9 53465227 missense probably benign 0.09
R4466:Atm UTSW 9 53448169 nonsense probably null
R4502:Atm UTSW 9 53495946 missense possibly damaging 0.92
R4514:Atm UTSW 9 53493039 missense probably damaging 0.99
R4528:Atm UTSW 9 53500759 missense probably benign 0.39
R4593:Atm UTSW 9 53453594 missense possibly damaging 0.55
R4627:Atm UTSW 9 53456506 missense possibly damaging 0.79
R4634:Atm UTSW 9 53531733 missense probably benign 0.01
R4665:Atm UTSW 9 53464229 missense probably benign 0.00
R4672:Atm UTSW 9 53522201 missense probably damaging 0.99
R4741:Atm UTSW 9 53453607 missense probably benign 0.10
R4808:Atm UTSW 9 53445495 missense probably damaging 0.99
R4959:Atm UTSW 9 53515301 missense probably benign
R4996:Atm UTSW 9 53524507 missense probably benign 0.09
R5030:Atm UTSW 9 53520109 nonsense probably null
R5214:Atm UTSW 9 53491027 missense probably benign 0.09
R5260:Atm UTSW 9 53506611 missense probably damaging 0.99
R5311:Atm UTSW 9 53518623 missense probably benign 0.00
R5394:Atm UTSW 9 53507777 critical splice donor site probably null
R5400:Atm UTSW 9 53503018 missense probably damaging 1.00
R5436:Atm UTSW 9 53459804 missense probably benign 0.00
R5441:Atm UTSW 9 53516467 nonsense probably null
R5569:Atm UTSW 9 53516450 nonsense probably null
R5856:Atm UTSW 9 53495955 missense possibly damaging 0.64
R5891:Atm UTSW 9 53497159 missense probably benign
R5910:Atm UTSW 9 53448080 missense probably damaging 0.96
R6054:Atm UTSW 9 53459873 missense probably damaging 1.00
R6062:Atm UTSW 9 53488587 missense probably damaging 1.00
R6092:Atm UTSW 9 53524414 missense probably damaging 1.00
R6127:Atm UTSW 9 53524509 missense probably damaging 1.00
R6160:Atm UTSW 9 53490959 missense probably benign 0.04
R6267:Atm UTSW 9 53444000 missense probably damaging 1.00
R6273:Atm UTSW 9 53487922 missense probably benign 0.09
R6284:Atm UTSW 9 53445376 splice site probably null
R6478:Atm UTSW 9 53490254 missense probably damaging 1.00
R6547:Atm UTSW 9 53440157 missense probably damaging 1.00
R6549:Atm UTSW 9 53493177 missense probably benign 0.00
R6704:Atm UTSW 9 53458853 missense probably benign 0.02
R6715:Atm UTSW 9 53531648 missense probably damaging 1.00
R6737:Atm UTSW 9 53486051 missense probably benign 0.30
R6759:Atm UTSW 9 53518559 nonsense probably null
R6766:Atm UTSW 9 53490282 missense probably damaging 0.99
R6813:Atm UTSW 9 53497235 missense probably benign 0.00
R6852:Atm UTSW 9 53482430 missense possibly damaging 0.93
R7064:Atm UTSW 9 53507881 missense probably benign 0.02
R7208:Atm UTSW 9 53512008 splice site probably null
R7211:Atm UTSW 9 53488560 missense probably benign 0.01
R7220:Atm UTSW 9 53511917 nonsense probably null
R7336:Atm UTSW 9 53462503 missense possibly damaging 0.47
R7363:Atm UTSW 9 53465298 missense probably damaging 1.00
R7378:Atm UTSW 9 53453437 critical splice acceptor site probably null
R7472:Atm UTSW 9 53448125 missense possibly damaging 0.81
R7487:Atm UTSW 9 53524354 missense probably benign
R7497:Atm UTSW 9 53511891 missense probably benign 0.00
R7584:Atm UTSW 9 53513127 missense probably damaging 0.99
R7624:Atm UTSW 9 53454768 missense probably damaging 0.99
R7660:Atm UTSW 9 53445507 missense probably benign 0.01
R7679:Atm UTSW 9 53442497 missense probably damaging 1.00
R7720:Atm UTSW 9 53522239 missense possibly damaging 0.54
R8221:Atm UTSW 9 53455988 splice site probably null
R8247:Atm UTSW 9 53450570 missense
R8334:Atm UTSW 9 53522273 missense probably benign 0.00
R8503:Atm UTSW 9 53488052 missense probably damaging 0.99
R8552:Atm UTSW 9 53524497 missense probably damaging 1.00
R8749:Atm UTSW 9 53499197 nonsense probably null
R8838:Atm UTSW 9 53516551 missense probably damaging 0.99
X0067:Atm UTSW 9 53479694 missense probably benign 0.00
Z1088:Atm UTSW 9 53531687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTCTGTTGTAATGTCTCACTCAC -3'
(R):5'- TAGCTCAGAGAACATGTTTCCTG -3'

Sequencing Primer
(F):5'- CACCTTTTGTTGATGTAGTGAATCAG -3'
(R):5'- GGTGGCACAGTCCTTTAAACCTAG -3'
Posted On2019-10-07