Incidental Mutation 'R7653:Chrna5'
ID 580482
Institutional Source Beutler Lab
Gene Symbol Chrna5
Ensembl Gene ENSMUSG00000035594
Gene Name cholinergic receptor, nicotinic, alpha polypeptide 5
Synonyms Acra-5, Acra5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock # R7653 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 54980880-55007779 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55002434 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 113 (D113V)
Ref Sequence ENSEMBL: ENSMUSP00000150942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093844] [ENSMUST00000213960] [ENSMUST00000217408]
AlphaFold Q2MKA5
Predicted Effect probably benign
Transcript: ENSMUST00000093844
AA Change: D84V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091365
Gene: ENSMUSG00000035594
AA Change: D84V

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 18 221 4.9e-72 PFAM
Pfam:Neur_chan_memb 228 352 1.9e-51 PFAM
Pfam:Neur_chan_memb 338 417 1.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213960
AA Change: D113V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217408
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nicotinic acetylcholine receptor subunit and a member of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. These receptors are thought to be heteropentamers composed of separate but similar subunits. Defects in this gene have been linked to susceptibility to lung cancer type 2 (LNCR2).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are less sensitive to nicotine-induced seizures than wild-type controls and exhibit a significantly shorter latency time to seizure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik A T 6: 92,828,069 Q70L unknown Het
Adamts12 T A 15: 11,257,029 N489K probably benign Het
Alms1 A G 6: 85,620,595 D801G possibly damaging Het
Apex1 T G 14: 50,926,538 N173K probably damaging Het
Arhgap32 A T 9: 32,257,145 N808I probably benign Het
Arhgef28 T C 13: 97,969,313 Y706C probably benign Het
Atg2b A T 12: 105,636,472 F1604Y possibly damaging Het
Atm A T 9: 53,490,302 Y1422* probably null Het
Bace2 T A 16: 97,436,652 V38E Het
BC053393 A C 11: 46,584,373 S132R probably benign Het
Birc6 C A 17: 74,647,734 L3442I possibly damaging Het
C6 T A 15: 4,814,762 S889T Het
Calcrl A T 2: 84,345,185 L275* probably null Het
Casp6 T C 3: 129,912,223 Y180H probably benign Het
Cd5 T C 19: 10,726,546 M51V probably benign Het
Cdhr1 G T 14: 37,082,201 P500Q probably benign Het
Celsr3 G A 9: 108,835,070 W1732* probably null Het
Ces2g T C 8: 104,962,653 V87A probably damaging Het
Chil6 T C 3: 106,394,325 N153S possibly damaging Het
Cox20 A G 1: 178,322,599 T113A probably benign Het
Cryl1 T C 14: 57,303,691 I179V probably benign Het
Dennd3 A G 15: 73,562,426 T982A probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
Dync2h1 A G 9: 7,117,570 S2240P probably benign Het
Fam166b T G 4: 43,427,273 probably null Het
Fbxl5 C T 5: 43,758,774 S432N probably benign Het
Fez1 T A 9: 36,860,850 S150R probably benign Het
Gabrb2 T G 11: 42,487,212 M85R probably damaging Het
Gm2035 T A 12: 87,919,478 D127V unknown Het
Lhx4 A G 1: 155,704,871 V203A probably damaging Het
Med23 G A 10: 24,904,384 D977N probably damaging Het
Mplkip T C 13: 17,695,782 F100L probably damaging Het
Ncoa7 C T 10: 30,694,243 G240E probably damaging Het
Nedd4 A G 9: 72,743,628 E827G probably damaging Het
Nfatc2 A G 2: 168,571,145 F207L probably benign Het
Nr2f1 A T 13: 78,195,597 S183T probably benign Het
Ocel1 A G 8: 71,371,916 E81G probably benign Het
Olfr1513 C A 14: 52,349,432 G205* probably null Het
Olfr432 T C 1: 174,050,922 V183A probably benign Het
Olfr733 C T 14: 50,299,147 G54E possibly damaging Het
Pcdh8 G A 14: 79,767,646 P980S probably benign Het
Pex26 A T 6: 121,193,551 Q285L possibly damaging Het
Plce1 A T 19: 38,749,319 N1603I probably benign Het
Poli A T 18: 70,509,627 C501S probably benign Het
Ppp4r4 C T 12: 103,584,145 T276I probably damaging Het
Rbpj T A 5: 53,590,351 M1K probably null Het
Recql4 T A 15: 76,703,782 M1204L probably benign Het
Ribc2 T C 15: 85,141,675 I284T probably benign Het
Rreb1 C A 13: 37,930,386 Q574K probably benign Het
Scn9a A T 2: 66,527,080 L959Q probably damaging Het
Shank1 C A 7: 44,319,669 H329Q unknown Het
Soat2 A T 15: 102,162,578 D469V probably damaging Het
Spag7 T A 11: 70,664,865 H82L probably damaging Het
Sptb T C 12: 76,628,497 I248V probably benign Het
Tacr3 A G 3: 134,861,082 I239V probably benign Het
Tbc1d1 T C 5: 64,256,790 F165L probably benign Het
Tchhl1 A G 3: 93,471,144 E385G probably benign Het
Tecta C T 9: 42,337,236 D1957N probably damaging Het
Tenm2 T C 11: 36,047,347 I1501V probably benign Het
Tet2 G T 3: 133,486,385 Q763K probably benign Het
Tmem8 T A 17: 26,120,449 M579K probably damaging Het
Tox3 G A 8: 90,248,989 T338I probably damaging Het
Usp30 G A 5: 114,121,669 D479N probably damaging Het
Vmn1r27 T C 6: 58,215,800 D73G possibly damaging Het
Vmn1r27 A T 6: 58,215,894 S42T probably benign Het
Vmn2r120 A T 17: 57,509,258 V699D possibly damaging Het
Vwa2 A T 19: 56,909,335 T691S probably benign Het
Wdr31 T A 4: 62,463,429 Q55L probably benign Het
Xdh A G 17: 73,897,045 F1107L probably benign Het
Zfp184 A G 13: 21,959,717 H531R probably damaging Het
Zfp366 T C 13: 99,229,201 L290P probably damaging Het
Other mutations in Chrna5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Chrna5 APN 9 55004399 missense possibly damaging 0.61
IGL01503:Chrna5 APN 9 54998171 intron probably benign
IGL01617:Chrna5 APN 9 55005013 missense probably damaging 0.98
IGL01935:Chrna5 APN 9 55004843 missense probably benign 0.01
IGL02613:Chrna5 APN 9 55006421 missense probably damaging 0.99
IGL03248:Chrna5 APN 9 55004639 missense probably damaging 1.00
IGL03412:Chrna5 APN 9 55004435 missense probably damaging 1.00
R0712:Chrna5 UTSW 9 55004363 missense probably damaging 1.00
R1619:Chrna5 UTSW 9 55004365 missense probably benign 0.00
R1698:Chrna5 UTSW 9 55004642 missense probably damaging 1.00
R1789:Chrna5 UTSW 9 55004651 missense possibly damaging 0.94
R1800:Chrna5 UTSW 9 55004875 missense probably damaging 0.99
R4028:Chrna5 UTSW 9 54998086 missense probably damaging 1.00
R4030:Chrna5 UTSW 9 54998086 missense probably damaging 1.00
R4031:Chrna5 UTSW 9 54998086 missense probably damaging 1.00
R4201:Chrna5 UTSW 9 54998075 missense probably benign 0.00
R4792:Chrna5 UTSW 9 55004701 missense probably damaging 1.00
R5196:Chrna5 UTSW 9 55006519 missense possibly damaging 0.91
R5718:Chrna5 UTSW 9 54998105 missense probably benign 0.00
R5779:Chrna5 UTSW 9 54998104 missense probably benign 0.35
R6254:Chrna5 UTSW 9 55006456 missense probably benign 0.00
R6492:Chrna5 UTSW 9 54998063 missense probably benign 0.11
R6887:Chrna5 UTSW 9 55005133 missense probably benign 0.00
R6986:Chrna5 UTSW 9 55006457 missense possibly damaging 0.83
R7056:Chrna5 UTSW 9 54981701 intron probably benign
R7222:Chrna5 UTSW 9 54998063 missense probably benign 0.11
R7384:Chrna5 UTSW 9 55004833 missense probably damaging 1.00
R7572:Chrna5 UTSW 9 55006465 missense probably damaging 1.00
R7846:Chrna5 UTSW 9 55005107 missense probably benign 0.38
R8808:Chrna5 UTSW 9 54998064 missense probably benign 0.20
R8901:Chrna5 UTSW 9 55004453 missense probably damaging 1.00
R9303:Chrna5 UTSW 9 55004872 missense probably benign 0.16
R9716:Chrna5 UTSW 9 55004635 missense probably benign 0.00
Z1176:Chrna5 UTSW 9 55004482 missense probably damaging 1.00
Z1177:Chrna5 UTSW 9 55004956 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GCATTGTGCAGAGAATGGC -3'
(R):5'- ACTCCACATTGGCCATGTCC -3'

Sequencing Primer
(F):5'- GCAGAGAATGGCTTATTATTAGTCG -3'
(R):5'- TCATAGCTAAACAATTTGCAGACAAG -3'
Posted On 2019-10-07