Incidental Mutation 'R7653:Med23'
ID 580485
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Name mediator complex subunit 23
Synonyms ESTM7, 3000002A17Rik, X83317, Sur2, Crsp3, sno
MMRRC Submission 045730-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7653 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 24745889-24789358 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 24780282 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 977 (D977N)
Ref Sequence ENSEMBL: ENSMUSP00000090316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000177232]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000020159
AA Change: D971N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: D971N

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092646
AA Change: D977N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: D977N

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176285
AA Change: D611N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: D611N

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik A T 6: 92,805,050 (GRCm39) Q70L unknown Het
Adamts12 T A 15: 11,257,115 (GRCm39) N489K probably benign Het
Alms1 A G 6: 85,597,577 (GRCm39) D801G possibly damaging Het
Apex1 T G 14: 51,163,995 (GRCm39) N173K probably damaging Het
Arhgap32 A T 9: 32,168,441 (GRCm39) N808I probably benign Het
Arhgef28 T C 13: 98,105,821 (GRCm39) Y706C probably benign Het
Atg2b A T 12: 105,602,731 (GRCm39) F1604Y possibly damaging Het
Atm A T 9: 53,401,602 (GRCm39) Y1422* probably null Het
Bace2 T A 16: 97,237,852 (GRCm39) V38E Het
Birc6 C A 17: 74,954,729 (GRCm39) L3442I possibly damaging Het
C6 T A 15: 4,844,244 (GRCm39) S889T Het
Calcrl A T 2: 84,175,529 (GRCm39) L275* probably null Het
Casp6 T C 3: 129,705,872 (GRCm39) Y180H probably benign Het
Cd5 T C 19: 10,703,910 (GRCm39) M51V probably benign Het
Cdhr1 G T 14: 36,804,158 (GRCm39) P500Q probably benign Het
Celsr3 G A 9: 108,712,269 (GRCm39) W1732* probably null Het
Ces2g T C 8: 105,689,285 (GRCm39) V87A probably damaging Het
Chil6 T C 3: 106,301,641 (GRCm39) N153S possibly damaging Het
Chrna5 A T 9: 54,909,718 (GRCm39) D113V probably benign Het
Cimip2b T G 4: 43,427,273 (GRCm39) probably null Het
Cox20 A G 1: 178,150,164 (GRCm39) T113A probably benign Het
Cryl1 T C 14: 57,541,148 (GRCm39) I179V probably benign Het
Dennd3 A G 15: 73,434,275 (GRCm39) T982A probably damaging Het
Drosha G A 15: 12,859,522 (GRCm39) V577I probably benign Het
Dync2h1 A G 9: 7,117,570 (GRCm39) S2240P probably benign Het
Eif1ad14 T A 12: 87,886,248 (GRCm39) D127V unknown Het
Fbxl5 C T 5: 43,916,116 (GRCm39) S432N probably benign Het
Fez1 T A 9: 36,772,146 (GRCm39) S150R probably benign Het
Gabrb2 T G 11: 42,378,039 (GRCm39) M85R probably damaging Het
Lhx4 A G 1: 155,580,617 (GRCm39) V203A probably damaging Het
Mplkip T C 13: 17,870,367 (GRCm39) F100L probably damaging Het
Ncoa7 C T 10: 30,570,239 (GRCm39) G240E probably damaging Het
Nedd4 A G 9: 72,650,910 (GRCm39) E827G probably damaging Het
Nfatc2 A G 2: 168,413,065 (GRCm39) F207L probably benign Het
Nr2f1 A T 13: 78,343,716 (GRCm39) S183T probably benign Het
Ocel1 A G 8: 71,824,560 (GRCm39) E81G probably benign Het
Or10aa3 T C 1: 173,878,488 (GRCm39) V183A probably benign Het
Or10g3b C A 14: 52,586,889 (GRCm39) G205* probably null Het
Or4n4b C T 14: 50,536,604 (GRCm39) G54E possibly damaging Het
Pcdh8 G A 14: 80,005,086 (GRCm39) P980S probably benign Het
Pex26 A T 6: 121,170,510 (GRCm39) Q285L possibly damaging Het
Pgap6 T A 17: 26,339,423 (GRCm39) M579K probably damaging Het
Plce1 A T 19: 38,737,763 (GRCm39) N1603I probably benign Het
Poli A T 18: 70,642,698 (GRCm39) C501S probably benign Het
Ppp4r4 C T 12: 103,550,404 (GRCm39) T276I probably damaging Het
Rbpj T A 5: 53,747,693 (GRCm39) M1K probably null Het
Recql4 T A 15: 76,587,982 (GRCm39) M1204L probably benign Het
Ribc2 T C 15: 85,025,876 (GRCm39) I284T probably benign Het
Rreb1 C A 13: 38,114,362 (GRCm39) Q574K probably benign Het
Scn9a A T 2: 66,357,424 (GRCm39) L959Q probably damaging Het
Shank1 C A 7: 43,969,093 (GRCm39) H329Q unknown Het
Soat2 A T 15: 102,071,013 (GRCm39) D469V probably damaging Het
Spag7 T A 11: 70,555,691 (GRCm39) H82L probably damaging Het
Sptb T C 12: 76,675,271 (GRCm39) I248V probably benign Het
Tacr3 A G 3: 134,566,843 (GRCm39) I239V probably benign Het
Tbc1d1 T C 5: 64,414,133 (GRCm39) F165L probably benign Het
Tchhl1 A G 3: 93,378,451 (GRCm39) E385G probably benign Het
Tecta C T 9: 42,248,532 (GRCm39) D1957N probably damaging Het
Tenm2 T C 11: 35,938,174 (GRCm39) I1501V probably benign Het
Tet2 G T 3: 133,192,146 (GRCm39) Q763K probably benign Het
Timd6 A C 11: 46,475,200 (GRCm39) S132R probably benign Het
Tox3 G A 8: 90,975,617 (GRCm39) T338I probably damaging Het
Usp30 G A 5: 114,259,730 (GRCm39) D479N probably damaging Het
Vmn1r27 T C 6: 58,192,785 (GRCm39) D73G possibly damaging Het
Vmn1r27 A T 6: 58,192,879 (GRCm39) S42T probably benign Het
Vmn2r120 A T 17: 57,816,258 (GRCm39) V699D possibly damaging Het
Vwa2 A T 19: 56,897,767 (GRCm39) T691S probably benign Het
Wdr31 T A 4: 62,381,666 (GRCm39) Q55L probably benign Het
Xdh A G 17: 74,204,040 (GRCm39) F1107L probably benign Het
Zfp184 A G 13: 22,143,887 (GRCm39) H531R probably damaging Het
Zfp366 T C 13: 99,365,709 (GRCm39) L290P probably damaging Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24,764,482 (GRCm39) missense probably damaging 1.00
IGL00792:Med23 APN 10 24,752,902 (GRCm39) missense possibly damaging 0.93
IGL01289:Med23 APN 10 24,778,019 (GRCm39) missense probably damaging 1.00
IGL01469:Med23 APN 10 24,758,495 (GRCm39) missense probably damaging 1.00
IGL01598:Med23 APN 10 24,779,696 (GRCm39) missense probably benign 0.34
IGL02324:Med23 APN 10 24,773,239 (GRCm39) missense probably damaging 0.98
IGL02381:Med23 APN 10 24,776,626 (GRCm39) missense possibly damaging 0.95
IGL02465:Med23 APN 10 24,779,641 (GRCm39) missense probably damaging 0.96
IGL02554:Med23 APN 10 24,774,473 (GRCm39) critical splice donor site probably null
IGL02683:Med23 APN 10 24,746,615 (GRCm39) missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24,750,469 (GRCm39) missense probably benign 0.01
R0080:Med23 UTSW 10 24,788,715 (GRCm39) missense probably benign 0.33
R0125:Med23 UTSW 10 24,776,686 (GRCm39) missense probably damaging 1.00
R0311:Med23 UTSW 10 24,773,256 (GRCm39) missense possibly damaging 0.95
R0765:Med23 UTSW 10 24,776,608 (GRCm39) missense probably damaging 1.00
R1302:Med23 UTSW 10 24,764,320 (GRCm39) splice site probably null
R1456:Med23 UTSW 10 24,779,550 (GRCm39) splice site probably benign
R1514:Med23 UTSW 10 24,768,565 (GRCm39) splice site probably benign
R1774:Med23 UTSW 10 24,779,584 (GRCm39) missense probably damaging 1.00
R1851:Med23 UTSW 10 24,786,768 (GRCm39) splice site probably null
R1928:Med23 UTSW 10 24,785,710 (GRCm39) missense probably benign
R1975:Med23 UTSW 10 24,786,664 (GRCm39) missense probably benign 0.01
R2011:Med23 UTSW 10 24,755,653 (GRCm39) missense possibly damaging 0.63
R2266:Med23 UTSW 10 24,750,499 (GRCm39) missense probably benign 0.00
R2309:Med23 UTSW 10 24,746,586 (GRCm39) missense probably damaging 0.99
R2507:Med23 UTSW 10 24,786,711 (GRCm39) missense probably damaging 1.00
R2566:Med23 UTSW 10 24,764,473 (GRCm39) missense probably damaging 1.00
R3720:Med23 UTSW 10 24,767,018 (GRCm39) missense probably damaging 1.00
R3771:Med23 UTSW 10 24,778,099 (GRCm39) missense probably damaging 1.00
R3811:Med23 UTSW 10 24,768,491 (GRCm39) splice site probably null
R3811:Med23 UTSW 10 24,768,490 (GRCm39) nonsense probably null
R4305:Med23 UTSW 10 24,780,168 (GRCm39) nonsense probably null
R4323:Med23 UTSW 10 24,746,603 (GRCm39) missense probably benign 0.02
R4701:Med23 UTSW 10 24,769,546 (GRCm39) missense probably damaging 1.00
R4886:Med23 UTSW 10 24,750,581 (GRCm39) critical splice donor site probably null
R4925:Med23 UTSW 10 24,786,645 (GRCm39) missense probably damaging 1.00
R4943:Med23 UTSW 10 24,751,567 (GRCm39) missense possibly damaging 0.92
R5207:Med23 UTSW 10 24,771,734 (GRCm39) nonsense probably null
R5749:Med23 UTSW 10 24,764,347 (GRCm39) missense possibly damaging 0.84
R5806:Med23 UTSW 10 24,783,119 (GRCm39) missense probably damaging 1.00
R5896:Med23 UTSW 10 24,778,043 (GRCm39) missense probably damaging 1.00
R5954:Med23 UTSW 10 24,746,381 (GRCm39) splice site probably benign
R6031:Med23 UTSW 10 24,779,646 (GRCm39) nonsense probably null
R6031:Med23 UTSW 10 24,779,646 (GRCm39) nonsense probably null
R6093:Med23 UTSW 10 24,754,341 (GRCm39) missense probably benign 0.16
R6107:Med23 UTSW 10 24,781,932 (GRCm39) nonsense probably null
R6356:Med23 UTSW 10 24,764,311 (GRCm39) missense probably damaging 0.98
R6393:Med23 UTSW 10 24,749,374 (GRCm39) missense possibly damaging 0.91
R6533:Med23 UTSW 10 24,769,518 (GRCm39) missense probably damaging 1.00
R6911:Med23 UTSW 10 24,778,079 (GRCm39) missense probably damaging 0.98
R6981:Med23 UTSW 10 24,771,722 (GRCm39) missense possibly damaging 0.92
R7085:Med23 UTSW 10 24,746,019 (GRCm39) missense probably damaging 1.00
R7215:Med23 UTSW 10 24,764,327 (GRCm39) missense probably benign
R7229:Med23 UTSW 10 24,777,902 (GRCm39) missense probably benign
R7489:Med23 UTSW 10 24,780,254 (GRCm39) missense probably damaging 1.00
R7530:Med23 UTSW 10 24,781,851 (GRCm39) missense probably benign 0.00
R7643:Med23 UTSW 10 24,781,863 (GRCm39) missense probably benign 0.01
R7764:Med23 UTSW 10 24,785,818 (GRCm39) critical splice donor site probably null
R7784:Med23 UTSW 10 24,778,346 (GRCm39) missense probably damaging 1.00
R8024:Med23 UTSW 10 24,755,581 (GRCm39) missense possibly damaging 0.74
R8182:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R8412:Med23 UTSW 10 24,784,632 (GRCm39) missense probably benign 0.01
R8874:Med23 UTSW 10 24,771,617 (GRCm39) missense possibly damaging 0.92
R8975:Med23 UTSW 10 24,780,334 (GRCm39) missense probably benign 0.42
R9131:Med23 UTSW 10 24,780,279 (GRCm39) missense
R9202:Med23 UTSW 10 24,780,202 (GRCm39) missense probably benign 0.12
R9341:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R9342:Med23 UTSW 10 24,750,469 (GRCm39) missense probably benign 0.01
R9343:Med23 UTSW 10 24,788,705 (GRCm39) missense probably benign
R9412:Med23 UTSW 10 24,778,019 (GRCm39) missense probably damaging 1.00
RF003:Med23 UTSW 10 24,779,683 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGATTTAAGGAGGCATGTGC -3'
(R):5'- ACCACTTTTACTACATGGCGTG -3'

Sequencing Primer
(F):5'- GTAGCTCTTTTGTGCTCGC -3'
(R):5'- GTGCTCAGCCTATCTGTTCATAAAGG -3'
Posted On 2019-10-07