Incidental Mutation 'R7653:Olfr733'
ID580502
Institutional Source Beutler Lab
Gene Symbol Olfr733
Ensembl Gene ENSMUSG00000090874
Gene Nameolfactory receptor 733
SynonymsMOR241-2, GA_x6K02T2PMLR-5992342-5991416
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R7653 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location50295891-50301522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50299147 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 54 (G54E)
Ref Sequence ENSEMBL: ENSMUSP00000149085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163469] [ENSMUST00000214372] [ENSMUST00000214756] [ENSMUST00000216195]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163469
AA Change: G54E

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128332
Gene: ENSMUSG00000090874
AA Change: G54E

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 6.4e-41 PFAM
Pfam:7tm_1 41 288 1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214372
AA Change: G54E

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214756
AA Change: G54E

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216195
AA Change: G54E

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik A T 6: 92,828,069 Q70L unknown Het
Adamts12 T A 15: 11,257,029 N489K probably benign Het
Alms1 A G 6: 85,620,595 D801G possibly damaging Het
Apex1 T G 14: 50,926,538 N173K probably damaging Het
Arhgap32 A T 9: 32,257,145 N808I probably benign Het
Arhgef28 T C 13: 97,969,313 Y706C probably benign Het
Atg2b A T 12: 105,636,472 F1604Y possibly damaging Het
Atm A T 9: 53,490,302 Y1422* probably null Het
Bace2 T A 16: 97,436,652 V38E Het
BC053393 A C 11: 46,584,373 S132R probably benign Het
Birc6 C A 17: 74,647,734 L3442I possibly damaging Het
C6 T A 15: 4,814,762 S889T Het
Calcrl A T 2: 84,345,185 L275* probably null Het
Casp6 T C 3: 129,912,223 Y180H probably benign Het
Cd5 T C 19: 10,726,546 M51V probably benign Het
Cdhr1 G T 14: 37,082,201 P500Q probably benign Het
Celsr3 G A 9: 108,835,070 W1732* probably null Het
Ces2g T C 8: 104,962,653 V87A probably damaging Het
Chil6 T C 3: 106,394,325 N153S possibly damaging Het
Chrna5 A T 9: 55,002,434 D113V probably benign Het
Cox20 A G 1: 178,322,599 T113A probably benign Het
Cryl1 T C 14: 57,303,691 I179V probably benign Het
Dennd3 A G 15: 73,562,426 T982A probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
Dync2h1 A G 9: 7,117,570 S2240P probably benign Het
Fam166b T G 4: 43,427,273 probably null Het
Fbxl5 C T 5: 43,758,774 S432N probably benign Het
Fez1 T A 9: 36,860,850 S150R probably benign Het
Gabrb2 T G 11: 42,487,212 M85R probably damaging Het
Gm2035 T A 12: 87,919,478 D127V unknown Het
Lhx4 A G 1: 155,704,871 V203A probably damaging Het
Med23 G A 10: 24,904,384 D977N probably damaging Het
Mplkip T C 13: 17,695,782 F100L probably damaging Het
Ncoa7 C T 10: 30,694,243 G240E probably damaging Het
Nedd4 A G 9: 72,743,628 E827G probably damaging Het
Nfatc2 A G 2: 168,571,145 F207L probably benign Het
Nr2f1 A T 13: 78,195,597 S183T probably benign Het
Ocel1 A G 8: 71,371,916 E81G probably benign Het
Olfr1513 C A 14: 52,349,432 G205* probably null Het
Olfr432 T C 1: 174,050,922 V183A probably benign Het
Pcdh8 G A 14: 79,767,646 P980S probably benign Het
Pex26 A T 6: 121,193,551 Q285L possibly damaging Het
Plce1 A T 19: 38,749,319 N1603I probably benign Het
Poli A T 18: 70,509,627 C501S probably benign Het
Ppp4r4 C T 12: 103,584,145 T276I probably damaging Het
Rbpj T A 5: 53,590,351 M1K probably null Het
Recql4 T A 15: 76,703,782 M1204L probably benign Het
Ribc2 T C 15: 85,141,675 I284T probably benign Het
Rreb1 C A 13: 37,930,386 Q574K probably benign Het
Scn9a A T 2: 66,527,080 L959Q probably damaging Het
Shank1 C A 7: 44,319,669 H329Q unknown Het
Soat2 A T 15: 102,162,578 D469V probably damaging Het
Spag7 T A 11: 70,664,865 H82L probably damaging Het
Sptb T C 12: 76,628,497 I248V probably benign Het
Tacr3 A G 3: 134,861,082 I239V probably benign Het
Tbc1d1 T C 5: 64,256,790 F165L probably benign Het
Tchhl1 A G 3: 93,471,144 E385G probably benign Het
Tecta C T 9: 42,337,236 D1957N probably damaging Het
Tenm2 T C 11: 36,047,347 I1501V probably benign Het
Tet2 G T 3: 133,486,385 Q763K probably benign Het
Tmem8 T A 17: 26,120,449 M579K probably damaging Het
Tox3 G A 8: 90,248,989 T338I probably damaging Het
Usp30 G A 5: 114,121,669 D479N probably damaging Het
Vmn1r27 T C 6: 58,215,800 D73G possibly damaging Het
Vmn1r27 A T 6: 58,215,894 S42T probably benign Het
Vmn2r120 A T 17: 57,509,258 V699D possibly damaging Het
Vwa2 A T 19: 56,909,335 T691S probably benign Het
Wdr31 T A 4: 62,463,429 Q55L probably benign Het
Xdh A G 17: 73,897,045 F1107L probably benign Het
Zfp184 A G 13: 21,959,717 H531R probably damaging Het
Zfp366 T C 13: 99,229,201 L290P probably damaging Het
Other mutations in Olfr733
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Olfr733 APN 14 50298512 missense probably benign 0.00
IGL02247:Olfr733 APN 14 50299114 missense probably damaging 1.00
IGL02307:Olfr733 APN 14 50298838 missense probably damaging 1.00
IGL02492:Olfr733 APN 14 50298603 missense probably damaging 1.00
PIT4378001:Olfr733 UTSW 14 50298898 missense probably benign
R0544:Olfr733 UTSW 14 50298682 missense probably benign 0.20
R1603:Olfr733 UTSW 14 50299034 missense possibly damaging 0.95
R1881:Olfr733 UTSW 14 50299015 missense probably damaging 1.00
R3731:Olfr733 UTSW 14 50298505 missense probably damaging 1.00
R4271:Olfr733 UTSW 14 50298451 missense probably damaging 1.00
R4512:Olfr733 UTSW 14 50298996 missense probably damaging 1.00
R5601:Olfr733 UTSW 14 50298861 missense probably damaging 1.00
R6468:Olfr733 UTSW 14 50298467 missense probably benign 0.02
R6614:Olfr733 UTSW 14 50299037 missense probably benign 0.00
R7013:Olfr733 UTSW 14 50299199 missense probably damaging 0.99
R7083:Olfr733 UTSW 14 50299279 missense possibly damaging 0.81
R7274:Olfr733 UTSW 14 50298422 missense probably benign 0.01
R7493:Olfr733 UTSW 14 50298824 missense probably benign 0.02
R7659:Olfr733 UTSW 14 50299241 missense probably benign 0.00
R7885:Olfr733 UTSW 14 50298584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGTAGCGGTCAAAGGCC -3'
(R):5'- ACACCAGTGTCTAACTATGCTTC -3'

Sequencing Primer
(F):5'- TGTAGCGGTCAAAGGCCATTAC -3'
(R):5'- AGCTATGTTCTAGTTAGAAGAGGC -3'
Posted On2019-10-07