Mutagenetix > Incidental Mutation

Incidental Mutation 'R7653:Adamts12'

580508

Institutional Source

Beutler Lab

Gene Symbol

Adamts12

Ensembl Gene

ENSMUSG00000047497

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12

Synonyms

AI605170; ADAMTS-12

MMRRC Submission

045730-MU

Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R7653 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

11064790-11349231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 11257029 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 489 (N489K)

Ref Sequence

ENSEMBL: ENSMUSP00000057796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061318]

AlphaFold

Q811B3

Predicted Effect

probably benign
Transcript: ENSMUST00000061318
AA Change: N489K

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: N489K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Pep_M12B_propep	53	197	5.5e-30	PFAM
low complexity region	236	245	N/A	INTRINSIC
Pfam:Reprolysin_5	248	438	1.6e-14	PFAM
Pfam:Reprolysin_4	248	453	6.7e-8	PFAM
Pfam:Reprolysin	250	460	1.2e-27	PFAM
Pfam:Reprolysin_2	268	450	5.5e-11	PFAM
Pfam:Reprolysin_3	272	407	3.5e-10	PFAM
TSP1	549	601	9.29e-14	SMART
Pfam:ADAM_spacer1	706	817	4.8e-36	PFAM
TSP1	831	887	4.66e-5	SMART
TSP1	890	949	2.54e-1	SMART
TSP1	951	1001	8.95e-7	SMART
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC
TSP1	1321	1371	2.22e-2	SMART
TSP1	1372	1431	9.97e-2	SMART
TSP1	1432	1479	1.19e-2	SMART
TSP1	1480	1538	2.63e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730049H05Rik	A	T	6: 92,828,069	Q70L	unknown	Het
Alms1	A	G	6: 85,620,595	D801G	possibly damaging	Het
Apex1	T	G	14: 50,926,538	N173K	probably damaging	Het
Arhgap32	A	T	9: 32,257,145	N808I	probably benign	Het
Arhgef28	T	C	13: 97,969,313	Y706C	probably benign	Het
Atg2b	A	T	12: 105,636,472	F1604Y	possibly damaging	Het
Atm	A	T	9: 53,490,302	Y1422*	probably null	Het
Bace2	T	A	16: 97,436,652	V38E		Het
BC053393	A	C	11: 46,584,373	S132R	probably benign	Het
Birc6	C	A	17: 74,647,734	L3442I	possibly damaging	Het
C6	T	A	15: 4,814,762	S889T		Het
Calcrl	A	T	2: 84,345,185	L275*	probably null	Het
Casp6	T	C	3: 129,912,223	Y180H	probably benign	Het
Cd5	T	C	19: 10,726,546	M51V	probably benign	Het
Cdhr1	G	T	14: 37,082,201	P500Q	probably benign	Het
Celsr3	G	A	9: 108,835,070	W1732*	probably null	Het
Ces2g	T	C	8: 104,962,653	V87A	probably damaging	Het
Chil6	T	C	3: 106,394,325	N153S	possibly damaging	Het
Chrna5	A	T	9: 55,002,434	D113V	probably benign	Het
Cox20	A	G	1: 178,322,599	T113A	probably benign	Het
Cryl1	T	C	14: 57,303,691	I179V	probably benign	Het
Dennd3	A	G	15: 73,562,426	T982A	probably damaging	Het
Drosha	G	A	15: 12,859,436	V577I	probably benign	Het
Dync2h1	A	G	9: 7,117,570	S2240P	probably benign	Het
Fam166b	T	G	4: 43,427,273		probably null	Het
Fbxl5	C	T	5: 43,758,774	S432N	probably benign	Het
Fez1	T	A	9: 36,860,850	S150R	probably benign	Het
Gabrb2	T	G	11: 42,487,212	M85R	probably damaging	Het
Gm2035	T	A	12: 87,919,478	D127V	unknown	Het
Lhx4	A	G	1: 155,704,871	V203A	probably damaging	Het
Med23	G	A	10: 24,904,384	D977N	probably damaging	Het
Mplkip	T	C	13: 17,695,782	F100L	probably damaging	Het
Ncoa7	C	T	10: 30,694,243	G240E	probably damaging	Het
Nedd4	A	G	9: 72,743,628	E827G	probably damaging	Het
Nfatc2	A	G	2: 168,571,145	F207L	probably benign	Het
Nr2f1	A	T	13: 78,195,597	S183T	probably benign	Het
Ocel1	A	G	8: 71,371,916	E81G	probably benign	Het
Olfr1513	C	A	14: 52,349,432	G205*	probably null	Het
Olfr432	T	C	1: 174,050,922	V183A	probably benign	Het
Olfr733	C	T	14: 50,299,147	G54E	possibly damaging	Het
Pcdh8	G	A	14: 79,767,646	P980S	probably benign	Het
Pex26	A	T	6: 121,193,551	Q285L	possibly damaging	Het
Plce1	A	T	19: 38,749,319	N1603I	probably benign	Het
Poli	A	T	18: 70,509,627	C501S	probably benign	Het
Ppp4r4	C	T	12: 103,584,145	T276I	probably damaging	Het
Rbpj	T	A	5: 53,590,351	M1K	probably null	Het
Recql4	T	A	15: 76,703,782	M1204L	probably benign	Het
Ribc2	T	C	15: 85,141,675	I284T	probably benign	Het
Rreb1	C	A	13: 37,930,386	Q574K	probably benign	Het
Scn9a	A	T	2: 66,527,080	L959Q	probably damaging	Het
Shank1	C	A	7: 44,319,669	H329Q	unknown	Het
Soat2	A	T	15: 102,162,578	D469V	probably damaging	Het
Spag7	T	A	11: 70,664,865	H82L	probably damaging	Het
Sptb	T	C	12: 76,628,497	I248V	probably benign	Het
Tacr3	A	G	3: 134,861,082	I239V	probably benign	Het
Tbc1d1	T	C	5: 64,256,790	F165L	probably benign	Het
Tchhl1	A	G	3: 93,471,144	E385G	probably benign	Het
Tecta	C	T	9: 42,337,236	D1957N	probably damaging	Het
Tenm2	T	C	11: 36,047,347	I1501V	probably benign	Het
Tet2	G	T	3: 133,486,385	Q763K	probably benign	Het
Tmem8	T	A	17: 26,120,449	M579K	probably damaging	Het
Tox3	G	A	8: 90,248,989	T338I	probably damaging	Het
Usp30	G	A	5: 114,121,669	D479N	probably damaging	Het
Vmn1r27	T	C	6: 58,215,800	D73G	possibly damaging	Het
Vmn1r27	A	T	6: 58,215,894	S42T	probably benign	Het
Vmn2r120	A	T	17: 57,509,258	V699D	possibly damaging	Het
Vwa2	A	T	19: 56,909,335	T691S	probably benign	Het
Wdr31	T	A	4: 62,463,429	Q55L	probably benign	Het
Xdh	A	G	17: 73,897,045	F1107L	probably benign	Het
Zfp184	A	G	13: 21,959,717	H531R	probably damaging	Het
Zfp366	T	C	13: 99,229,201	L290P	probably damaging	Het

Other mutations in Adamts12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Adamts12	APN	15	11311599	missense	probably benign	0.00
IGL00513:Adamts12	APN	15	11256961	missense	probably benign	0.28
IGL00579:Adamts12	APN	15	11152014	missense	probably benign	0.20
IGL00984:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL01307:Adamts12	APN	15	11237546	missense	possibly damaging	0.88
IGL01314:Adamts12	APN	15	11071853	missense	probably benign	0.30
IGL01353:Adamts12	APN	15	11292005	splice site	probably benign
IGL01373:Adamts12	APN	15	11310730	missense	probably benign	0.00
IGL01522:Adamts12	APN	15	11065159	critical splice donor site	probably null
IGL01589:Adamts12	APN	15	11311237	missense	probably benign	0.26
IGL01715:Adamts12	APN	15	11258096	missense	possibly damaging	0.47
IGL01966:Adamts12	APN	15	11258183	missense	probably damaging	0.98
IGL01994:Adamts12	APN	15	11345594	missense	probably damaging	1.00
IGL02058:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL02216:Adamts12	APN	15	11241485	missense	possibly damaging	0.63
IGL02252:Adamts12	APN	15	11311015	missense	probably benign	0.01
IGL02336:Adamts12	APN	15	11311245	missense	probably benign	0.02
IGL02445:Adamts12	APN	15	11286712	missense	probably damaging	1.00
IGL03115:Adamts12	APN	15	11263336	missense	probably damaging	1.00
IGL03131:Adamts12	APN	15	11345564	missense	probably damaging	1.00
IGL03161:Adamts12	APN	15	11292082	missense	possibly damaging	0.93
IGL03403:Adamts12	APN	15	11241488	missense	probably damaging	1.00
I2289:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
PIT4677001:Adamts12	UTSW	15	11286810	missense	probably benign	0.33
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0028:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0122:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0196:Adamts12	UTSW	15	11071508	missense	probably benign	0.11
R0308:Adamts12	UTSW	15	11311560	missense	probably damaging	0.98
R0335:Adamts12	UTSW	15	11311058	missense	possibly damaging	0.95
R0667:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0729:Adamts12	UTSW	15	11255683	missense	possibly damaging	0.91
R1162:Adamts12	UTSW	15	11277458	critical splice donor site	probably null
R1173:Adamts12	UTSW	15	11071757	missense	probably benign
R1174:Adamts12	UTSW	15	11071757	missense	probably benign
R1319:Adamts12	UTSW	15	11286791	missense	probably benign	0.02
R1344:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1367:Adamts12	UTSW	15	11256894	splice site	probably benign
R1396:Adamts12	UTSW	15	11311472	missense	probably benign	0.01
R1418:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1447:Adamts12	UTSW	15	11263361	missense	probably benign	0.42
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1599:Adamts12	UTSW	15	11071711	missense	probably damaging	0.99
R1700:Adamts12	UTSW	15	11152057	missense	probably benign	0.00
R1748:Adamts12	UTSW	15	11241462	missense	probably damaging	0.99
R1826:Adamts12	UTSW	15	11071520	missense	probably benign	0.06
R1870:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1871:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1872:Adamts12	UTSW	15	11217880	nonsense	probably null
R1931:Adamts12	UTSW	15	11270599	missense	probably benign	0.00
R2041:Adamts12	UTSW	15	11215735	missense	probably damaging	1.00
R2119:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2120:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2122:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2161:Adamts12	UTSW	15	11215735	missense	probably damaging	0.99
R2655:Adamts12	UTSW	15	11065088	missense	possibly damaging	0.50
R4010:Adamts12	UTSW	15	11286083	missense	possibly damaging	0.69
R4208:Adamts12	UTSW	15	11071754	missense	probably benign
R4666:Adamts12	UTSW	15	11311492	missense	probably benign	0.08
R4731:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4732:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4733:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4766:Adamts12	UTSW	15	11285901	missense	probably benign	0.03
R4877:Adamts12	UTSW	15	11327701	missense	probably damaging	1.00
R4929:Adamts12	UTSW	15	11259022	missense	probably damaging	0.96
R5060:Adamts12	UTSW	15	11299968	missense	probably damaging	1.00
R5145:Adamts12	UTSW	15	11285876	missense	probably damaging	1.00
R5191:Adamts12	UTSW	15	11327757	missense	probably benign	0.18
R5492:Adamts12	UTSW	15	11336298	missense	probably benign	0.05
R5580:Adamts12	UTSW	15	11152000	missense	probably benign	0.14
R5645:Adamts12	UTSW	15	11277420	missense	possibly damaging	0.92
R5724:Adamts12	UTSW	15	11286750	missense	probably benign	0.15
R6240:Adamts12	UTSW	15	11285958	missense	probably benign	0.44
R6331:Adamts12	UTSW	15	11241433	missense	probably damaging	1.00
R6381:Adamts12	UTSW	15	11256994	missense	possibly damaging	0.93
R6393:Adamts12	UTSW	15	11255635	missense	probably damaging	0.97
R6419:Adamts12	UTSW	15	11215673	missense	possibly damaging	0.72
R6571:Adamts12	UTSW	15	11065101	missense	probably benign	0.00
R6821:Adamts12	UTSW	15	11152048	missense	probably benign	0.14
R6913:Adamts12	UTSW	15	11215692	missense	probably damaging	1.00
R6973:Adamts12	UTSW	15	11331780	nonsense	probably null
R7188:Adamts12	UTSW	15	11336325	nonsense	probably null
R7290:Adamts12	UTSW	15	11277366	missense	probably benign	0.08
R7307:Adamts12	UTSW	15	11217813	missense	probably damaging	1.00
R7376:Adamts12	UTSW	15	11277339	missense	possibly damaging	0.69
R7419:Adamts12	UTSW	15	11317279	missense	probably benign	0.00
R7484:Adamts12	UTSW	15	11345648	missense	probably benign	0.25
R7562:Adamts12	UTSW	15	11270611	missense	probably benign	0.01
R7696:Adamts12	UTSW	15	11258138	missense	probably damaging	1.00
R7957:Adamts12	UTSW	15	11317212	missense	possibly damaging	0.96
R7980:Adamts12	UTSW	15	11263337	missense	probably damaging	1.00
R7992:Adamts12	UTSW	15	11310818	missense	probably benign
R8032:Adamts12	UTSW	15	11259103	critical splice donor site	probably null
R8109:Adamts12	UTSW	15	11331791	missense	probably benign	0.02
R8402:Adamts12	UTSW	15	11263290	missense	probably damaging	0.96
R8751:Adamts12	UTSW	15	11215727	missense	probably damaging	1.00
R8782:Adamts12	UTSW	15	11237592	missense	probably damaging	1.00
R8934:Adamts12	UTSW	15	11299929	missense	probably damaging	0.99
R8952:Adamts12	UTSW	15	11285979	missense	probably damaging	1.00
R8963:Adamts12	UTSW	15	11317357	critical splice donor site	probably null
R9042:Adamts12	UTSW	15	11152048	missense	probably benign	0.08
R9162:Adamts12	UTSW	15	11311635	missense	probably benign	0.29
R9190:Adamts12	UTSW	15	11336360	missense	probably benign	0.02
R9700:Adamts12	UTSW	15	11311356	missense	probably benign	0.04
R9748:Adamts12	UTSW	15	11310542	missense	probably damaging	0.99
V1662:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
X0022:Adamts12	UTSW	15	11277448	missense	probably benign	0.30
Z1176:Adamts12	UTSW	15	11336383	missense	not run
Z1177:Adamts12	UTSW	15	11317324	missense	probably damaging	1.00
Z1177:Adamts12	UTSW	15	11336383	missense	not run

Predicted Primers

PCR Primer
(F):5'- CTGGATGATTGGAGAGAATCACATG -3'
(R):5'- GGACCTGTCTCCGAGTTGTATAG -3'

Sequencing Primer
(F):5'- GAATCACATGCAACTGATCTGG -3'
(R):5'- CAAGAAAGTTGGGTCAAAGATTCTC -3'

Posted On

2019-10-07