Incidental Mutation 'R7653:Adamts12'
ID 580508
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 12
Synonyms
MMRRC Submission 045730-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7653 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 11064876-11349317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 11257115 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 489 (N489K)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
AlphaFold Q811B3
Predicted Effect probably benign
Transcript: ENSMUST00000061318
AA Change: N489K

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: N489K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik A T 6: 92,805,050 (GRCm39) Q70L unknown Het
Alms1 A G 6: 85,597,577 (GRCm39) D801G possibly damaging Het
Apex1 T G 14: 51,163,995 (GRCm39) N173K probably damaging Het
Arhgap32 A T 9: 32,168,441 (GRCm39) N808I probably benign Het
Arhgef28 T C 13: 98,105,821 (GRCm39) Y706C probably benign Het
Atg2b A T 12: 105,602,731 (GRCm39) F1604Y possibly damaging Het
Atm A T 9: 53,401,602 (GRCm39) Y1422* probably null Het
Bace2 T A 16: 97,237,852 (GRCm39) V38E Het
Birc6 C A 17: 74,954,729 (GRCm39) L3442I possibly damaging Het
C6 T A 15: 4,844,244 (GRCm39) S889T Het
Calcrl A T 2: 84,175,529 (GRCm39) L275* probably null Het
Casp6 T C 3: 129,705,872 (GRCm39) Y180H probably benign Het
Cd5 T C 19: 10,703,910 (GRCm39) M51V probably benign Het
Cdhr1 G T 14: 36,804,158 (GRCm39) P500Q probably benign Het
Celsr3 G A 9: 108,712,269 (GRCm39) W1732* probably null Het
Ces2g T C 8: 105,689,285 (GRCm39) V87A probably damaging Het
Chil6 T C 3: 106,301,641 (GRCm39) N153S possibly damaging Het
Chrna5 A T 9: 54,909,718 (GRCm39) D113V probably benign Het
Cimip2b T G 4: 43,427,273 (GRCm39) probably null Het
Cox20 A G 1: 178,150,164 (GRCm39) T113A probably benign Het
Cryl1 T C 14: 57,541,148 (GRCm39) I179V probably benign Het
Dennd3 A G 15: 73,434,275 (GRCm39) T982A probably damaging Het
Drosha G A 15: 12,859,522 (GRCm39) V577I probably benign Het
Dync2h1 A G 9: 7,117,570 (GRCm39) S2240P probably benign Het
Eif1ad14 T A 12: 87,886,248 (GRCm39) D127V unknown Het
Fbxl5 C T 5: 43,916,116 (GRCm39) S432N probably benign Het
Fez1 T A 9: 36,772,146 (GRCm39) S150R probably benign Het
Gabrb2 T G 11: 42,378,039 (GRCm39) M85R probably damaging Het
Lhx4 A G 1: 155,580,617 (GRCm39) V203A probably damaging Het
Med23 G A 10: 24,780,282 (GRCm39) D977N probably damaging Het
Mplkip T C 13: 17,870,367 (GRCm39) F100L probably damaging Het
Ncoa7 C T 10: 30,570,239 (GRCm39) G240E probably damaging Het
Nedd4 A G 9: 72,650,910 (GRCm39) E827G probably damaging Het
Nfatc2 A G 2: 168,413,065 (GRCm39) F207L probably benign Het
Nr2f1 A T 13: 78,343,716 (GRCm39) S183T probably benign Het
Ocel1 A G 8: 71,824,560 (GRCm39) E81G probably benign Het
Or10aa3 T C 1: 173,878,488 (GRCm39) V183A probably benign Het
Or10g3b C A 14: 52,586,889 (GRCm39) G205* probably null Het
Or4n4b C T 14: 50,536,604 (GRCm39) G54E possibly damaging Het
Pcdh8 G A 14: 80,005,086 (GRCm39) P980S probably benign Het
Pex26 A T 6: 121,170,510 (GRCm39) Q285L possibly damaging Het
Pgap6 T A 17: 26,339,423 (GRCm39) M579K probably damaging Het
Plce1 A T 19: 38,737,763 (GRCm39) N1603I probably benign Het
Poli A T 18: 70,642,698 (GRCm39) C501S probably benign Het
Ppp4r4 C T 12: 103,550,404 (GRCm39) T276I probably damaging Het
Rbpj T A 5: 53,747,693 (GRCm39) M1K probably null Het
Recql4 T A 15: 76,587,982 (GRCm39) M1204L probably benign Het
Ribc2 T C 15: 85,025,876 (GRCm39) I284T probably benign Het
Rreb1 C A 13: 38,114,362 (GRCm39) Q574K probably benign Het
Scn9a A T 2: 66,357,424 (GRCm39) L959Q probably damaging Het
Shank1 C A 7: 43,969,093 (GRCm39) H329Q unknown Het
Soat2 A T 15: 102,071,013 (GRCm39) D469V probably damaging Het
Spag7 T A 11: 70,555,691 (GRCm39) H82L probably damaging Het
Sptb T C 12: 76,675,271 (GRCm39) I248V probably benign Het
Tacr3 A G 3: 134,566,843 (GRCm39) I239V probably benign Het
Tbc1d1 T C 5: 64,414,133 (GRCm39) F165L probably benign Het
Tchhl1 A G 3: 93,378,451 (GRCm39) E385G probably benign Het
Tecta C T 9: 42,248,532 (GRCm39) D1957N probably damaging Het
Tenm2 T C 11: 35,938,174 (GRCm39) I1501V probably benign Het
Tet2 G T 3: 133,192,146 (GRCm39) Q763K probably benign Het
Timd6 A C 11: 46,475,200 (GRCm39) S132R probably benign Het
Tox3 G A 8: 90,975,617 (GRCm39) T338I probably damaging Het
Usp30 G A 5: 114,259,730 (GRCm39) D479N probably damaging Het
Vmn1r27 T C 6: 58,192,785 (GRCm39) D73G possibly damaging Het
Vmn1r27 A T 6: 58,192,879 (GRCm39) S42T probably benign Het
Vmn2r120 A T 17: 57,816,258 (GRCm39) V699D possibly damaging Het
Vwa2 A T 19: 56,897,767 (GRCm39) T691S probably benign Het
Wdr31 T A 4: 62,381,666 (GRCm39) Q55L probably benign Het
Xdh A G 17: 74,204,040 (GRCm39) F1107L probably benign Het
Zfp184 A G 13: 22,143,887 (GRCm39) H531R probably damaging Het
Zfp366 T C 13: 99,365,709 (GRCm39) L290P probably damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11,311,685 (GRCm39) missense probably benign 0.00
IGL00513:Adamts12 APN 15 11,257,047 (GRCm39) missense probably benign 0.28
IGL00579:Adamts12 APN 15 11,152,100 (GRCm39) missense probably benign 0.20
IGL00984:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL01307:Adamts12 APN 15 11,237,632 (GRCm39) missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11,071,939 (GRCm39) missense probably benign 0.30
IGL01353:Adamts12 APN 15 11,292,091 (GRCm39) splice site probably benign
IGL01373:Adamts12 APN 15 11,310,816 (GRCm39) missense probably benign 0.00
IGL01522:Adamts12 APN 15 11,065,245 (GRCm39) critical splice donor site probably null
IGL01589:Adamts12 APN 15 11,311,323 (GRCm39) missense probably benign 0.26
IGL01715:Adamts12 APN 15 11,258,182 (GRCm39) missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11,258,269 (GRCm39) missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11,345,680 (GRCm39) missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL02216:Adamts12 APN 15 11,241,571 (GRCm39) missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11,311,101 (GRCm39) missense probably benign 0.01
IGL02336:Adamts12 APN 15 11,311,331 (GRCm39) missense probably benign 0.02
IGL02445:Adamts12 APN 15 11,286,798 (GRCm39) missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11,263,422 (GRCm39) missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11,345,650 (GRCm39) missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11,292,168 (GRCm39) missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11,241,574 (GRCm39) missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11,286,896 (GRCm39) missense probably benign 0.33
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0122:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11,071,594 (GRCm39) missense probably benign 0.11
R0308:Adamts12 UTSW 15 11,311,646 (GRCm39) missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11,311,144 (GRCm39) missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11,255,769 (GRCm39) missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11,277,544 (GRCm39) critical splice donor site probably null
R1173:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1174:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1319:Adamts12 UTSW 15 11,286,877 (GRCm39) missense probably benign 0.02
R1344:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11,256,980 (GRCm39) splice site probably benign
R1396:Adamts12 UTSW 15 11,311,558 (GRCm39) missense probably benign 0.01
R1418:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11,263,447 (GRCm39) missense probably benign 0.42
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1599:Adamts12 UTSW 15 11,071,797 (GRCm39) missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11,152,143 (GRCm39) missense probably benign 0.00
R1748:Adamts12 UTSW 15 11,241,548 (GRCm39) missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11,071,606 (GRCm39) missense probably benign 0.06
R1870:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1871:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1872:Adamts12 UTSW 15 11,217,966 (GRCm39) nonsense probably null
R1931:Adamts12 UTSW 15 11,270,685 (GRCm39) missense probably benign 0.00
R2041:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11,065,174 (GRCm39) missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11,286,169 (GRCm39) missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11,071,840 (GRCm39) missense probably benign
R4666:Adamts12 UTSW 15 11,311,578 (GRCm39) missense probably benign 0.08
R4731:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11,285,987 (GRCm39) missense probably benign 0.03
R4877:Adamts12 UTSW 15 11,327,787 (GRCm39) missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11,259,108 (GRCm39) missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11,300,054 (GRCm39) missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11,285,962 (GRCm39) missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11,327,843 (GRCm39) missense probably benign 0.18
R5492:Adamts12 UTSW 15 11,336,384 (GRCm39) missense probably benign 0.05
R5580:Adamts12 UTSW 15 11,152,086 (GRCm39) missense probably benign 0.14
R5645:Adamts12 UTSW 15 11,277,506 (GRCm39) missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11,286,836 (GRCm39) missense probably benign 0.15
R6240:Adamts12 UTSW 15 11,286,044 (GRCm39) missense probably benign 0.44
R6331:Adamts12 UTSW 15 11,241,519 (GRCm39) missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11,257,080 (GRCm39) missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11,255,721 (GRCm39) missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11,215,759 (GRCm39) missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11,065,187 (GRCm39) missense probably benign 0.00
R6821:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.14
R6913:Adamts12 UTSW 15 11,215,778 (GRCm39) missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11,331,866 (GRCm39) nonsense probably null
R7188:Adamts12 UTSW 15 11,336,411 (GRCm39) nonsense probably null
R7290:Adamts12 UTSW 15 11,277,452 (GRCm39) missense probably benign 0.08
R7307:Adamts12 UTSW 15 11,217,899 (GRCm39) missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11,277,425 (GRCm39) missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11,317,365 (GRCm39) missense probably benign 0.00
R7484:Adamts12 UTSW 15 11,345,734 (GRCm39) missense probably benign 0.25
R7562:Adamts12 UTSW 15 11,270,697 (GRCm39) missense probably benign 0.01
R7696:Adamts12 UTSW 15 11,258,224 (GRCm39) missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11,317,298 (GRCm39) missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11,263,423 (GRCm39) missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11,310,904 (GRCm39) missense probably benign
R8032:Adamts12 UTSW 15 11,259,189 (GRCm39) critical splice donor site probably null
R8109:Adamts12 UTSW 15 11,331,877 (GRCm39) missense probably benign 0.02
R8402:Adamts12 UTSW 15 11,263,376 (GRCm39) missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11,215,813 (GRCm39) missense probably damaging 1.00
R8782:Adamts12 UTSW 15 11,237,678 (GRCm39) missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11,300,015 (GRCm39) missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11,286,065 (GRCm39) missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11,317,443 (GRCm39) critical splice donor site probably null
R9042:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.08
R9162:Adamts12 UTSW 15 11,311,721 (GRCm39) missense probably benign 0.29
R9190:Adamts12 UTSW 15 11,336,446 (GRCm39) missense probably benign 0.02
R9700:Adamts12 UTSW 15 11,311,442 (GRCm39) missense probably benign 0.04
R9748:Adamts12 UTSW 15 11,310,628 (GRCm39) missense probably damaging 0.99
V1662:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
X0022:Adamts12 UTSW 15 11,277,534 (GRCm39) missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,317,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGATGATTGGAGAGAATCACATG -3'
(R):5'- GGACCTGTCTCCGAGTTGTATAG -3'

Sequencing Primer
(F):5'- GAATCACATGCAACTGATCTGG -3'
(R):5'- CAAGAAAGTTGGGTCAAAGATTCTC -3'
Posted On 2019-10-07