Incidental Mutation 'R7653:Recql4'
ID580511
Institutional Source Beutler Lab
Gene Symbol Recql4
Ensembl Gene ENSMUSG00000033762
Gene NameRecQ protein-like 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7653 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76703553-76710548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76703782 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1204 (M1204L)
Ref Sequence ENSEMBL: ENSMUSP00000044363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019224] [ENSMUST00000023203] [ENSMUST00000036852] [ENSMUST00000229140] [ENSMUST00000229679] [ENSMUST00000229734] [ENSMUST00000230544] [ENSMUST00000230724]
Predicted Effect probably benign
Transcript: ENSMUST00000019224
SMART Domains Protein: ENSMUSP00000019224
Gene: ENSMUSG00000019080

DomainStartEndE-ValueType
Pfam:MFS_1 8 373 3e-16 PFAM
transmembrane domain 388 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023203
SMART Domains Protein: ENSMUSP00000023203
Gene: ENSMUSG00000022546

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 83 484 7.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036852
AA Change: M1204L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762
AA Change: M1204L

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000229140
Predicted Effect probably benign
Transcript: ENSMUST00000229679
Predicted Effect probably benign
Transcript: ENSMUST00000229734
Predicted Effect probably benign
Transcript: ENSMUST00000230544
AA Change: M1161L

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000230724
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous loss of exons 5-8 causes embryonic death. Deletion of exon 13 causes neo- and postnatal lethality, stunted growth, skin, hair and bone defects, tissue hypoplasia and tooth dysgenesis. Mice lacking exons 9-13 show palate and limb defects, aneuploidy, poikiloderma and cancer predisposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik A T 6: 92,828,069 Q70L unknown Het
Adamts12 T A 15: 11,257,029 N489K probably benign Het
Alms1 A G 6: 85,620,595 D801G possibly damaging Het
Apex1 T G 14: 50,926,538 N173K probably damaging Het
Arhgap32 A T 9: 32,257,145 N808I probably benign Het
Arhgef28 T C 13: 97,969,313 Y706C probably benign Het
Atg2b A T 12: 105,636,472 F1604Y possibly damaging Het
Atm A T 9: 53,490,302 Y1422* probably null Het
Bace2 T A 16: 97,436,652 V38E Het
BC053393 A C 11: 46,584,373 S132R probably benign Het
Birc6 C A 17: 74,647,734 L3442I possibly damaging Het
C6 T A 15: 4,814,762 S889T Het
Calcrl A T 2: 84,345,185 L275* probably null Het
Casp6 T C 3: 129,912,223 Y180H probably benign Het
Cd5 T C 19: 10,726,546 M51V probably benign Het
Cdhr1 G T 14: 37,082,201 P500Q probably benign Het
Celsr3 G A 9: 108,835,070 W1732* probably null Het
Ces2g T C 8: 104,962,653 V87A probably damaging Het
Chil6 T C 3: 106,394,325 N153S possibly damaging Het
Chrna5 A T 9: 55,002,434 D113V probably benign Het
Cox20 A G 1: 178,322,599 T113A probably benign Het
Cryl1 T C 14: 57,303,691 I179V probably benign Het
Dennd3 A G 15: 73,562,426 T982A probably damaging Het
Drosha G A 15: 12,859,436 V577I probably benign Het
Dync2h1 A G 9: 7,117,570 S2240P probably benign Het
Fam166b T G 4: 43,427,273 probably null Het
Fbxl5 C T 5: 43,758,774 S432N probably benign Het
Fez1 T A 9: 36,860,850 S150R probably benign Het
Gabrb2 T G 11: 42,487,212 M85R probably damaging Het
Gm2035 T A 12: 87,919,478 D127V unknown Het
Lhx4 A G 1: 155,704,871 V203A probably damaging Het
Med23 G A 10: 24,904,384 D977N probably damaging Het
Mplkip T C 13: 17,695,782 F100L probably damaging Het
Ncoa7 C T 10: 30,694,243 G240E probably damaging Het
Nedd4 A G 9: 72,743,628 E827G probably damaging Het
Nfatc2 A G 2: 168,571,145 F207L probably benign Het
Nr2f1 A T 13: 78,195,597 S183T probably benign Het
Ocel1 A G 8: 71,371,916 E81G probably benign Het
Olfr1513 C A 14: 52,349,432 G205* probably null Het
Olfr432 T C 1: 174,050,922 V183A probably benign Het
Olfr733 C T 14: 50,299,147 G54E possibly damaging Het
Pcdh8 G A 14: 79,767,646 P980S probably benign Het
Pex26 A T 6: 121,193,551 Q285L possibly damaging Het
Plce1 A T 19: 38,749,319 N1603I probably benign Het
Poli A T 18: 70,509,627 C501S probably benign Het
Ppp4r4 C T 12: 103,584,145 T276I probably damaging Het
Rbpj T A 5: 53,590,351 M1K probably null Het
Ribc2 T C 15: 85,141,675 I284T probably benign Het
Rreb1 C A 13: 37,930,386 Q574K probably benign Het
Scn9a A T 2: 66,527,080 L959Q probably damaging Het
Shank1 C A 7: 44,319,669 H329Q unknown Het
Soat2 A T 15: 102,162,578 D469V probably damaging Het
Spag7 T A 11: 70,664,865 H82L probably damaging Het
Sptb T C 12: 76,628,497 I248V probably benign Het
Tacr3 A G 3: 134,861,082 I239V probably benign Het
Tbc1d1 T C 5: 64,256,790 F165L probably benign Het
Tchhl1 A G 3: 93,471,144 E385G probably benign Het
Tecta C T 9: 42,337,236 D1957N probably damaging Het
Tenm2 T C 11: 36,047,347 I1501V probably benign Het
Tet2 G T 3: 133,486,385 Q763K probably benign Het
Tmem8 T A 17: 26,120,449 M579K probably damaging Het
Tox3 G A 8: 90,248,989 T338I probably damaging Het
Usp30 G A 5: 114,121,669 D479N probably damaging Het
Vmn1r27 T C 6: 58,215,800 D73G possibly damaging Het
Vmn1r27 A T 6: 58,215,894 S42T probably benign Het
Vmn2r120 A T 17: 57,509,258 V699D possibly damaging Het
Vwa2 A T 19: 56,909,335 T691S probably benign Het
Wdr31 T A 4: 62,463,429 Q55L probably benign Het
Xdh A G 17: 73,897,045 F1107L probably benign Het
Zfp184 A G 13: 21,959,717 H531R probably damaging Het
Zfp366 T C 13: 99,229,201 L290P probably damaging Het
Other mutations in Recql4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Recql4 APN 15 76707336 missense possibly damaging 0.52
IGL01287:Recql4 APN 15 76709912 splice site probably benign
IGL01470:Recql4 APN 15 76708944 missense probably benign 0.40
IGL01809:Recql4 APN 15 76708870 nonsense probably null
IGL02094:Recql4 APN 15 76709517 missense probably benign 0.01
IGL02303:Recql4 APN 15 76708571 missense possibly damaging 0.64
IGL02702:Recql4 APN 15 76707285 missense probably damaging 1.00
IGL03086:Recql4 APN 15 76706268 missense probably benign 0.30
IGL03162:Recql4 APN 15 76706096 splice site probably null
ANU74:Recql4 UTSW 15 76705757 missense possibly damaging 0.47
F5770:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
R0688:Recql4 UTSW 15 76709809 splice site probably null
R1171:Recql4 UTSW 15 76704039 missense possibly damaging 0.94
R1348:Recql4 UTSW 15 76709211 missense probably benign 0.01
R1487:Recql4 UTSW 15 76708983 missense probably benign 0.11
R1547:Recql4 UTSW 15 76706311 missense probably damaging 0.99
R1917:Recql4 UTSW 15 76703837 nonsense probably null
R3813:Recql4 UTSW 15 76704494 missense possibly damaging 0.67
R4066:Recql4 UTSW 15 76705827 missense probably damaging 1.00
R4363:Recql4 UTSW 15 76706044 missense probably benign 0.07
R4387:Recql4 UTSW 15 76705958 missense probably benign 0.00
R4388:Recql4 UTSW 15 76705958 missense probably benign 0.00
R4700:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R4701:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R4923:Recql4 UTSW 15 76710181 missense probably damaging 1.00
R5075:Recql4 UTSW 15 76709544 missense probably damaging 1.00
R5103:Recql4 UTSW 15 76706756 missense probably damaging 1.00
R5226:Recql4 UTSW 15 76710129 missense probably benign
R5500:Recql4 UTSW 15 76705578 intron probably benign
R5547:Recql4 UTSW 15 76705794 nonsense probably null
R5824:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R5976:Recql4 UTSW 15 76709424 missense probably benign 0.01
R6086:Recql4 UTSW 15 76704587 missense probably damaging 0.96
R6756:Recql4 UTSW 15 76704859 missense probably benign 0.00
R7075:Recql4 UTSW 15 76706424 missense possibly damaging 0.95
R7086:Recql4 UTSW 15 76705553 missense unknown
R7449:Recql4 UTSW 15 76705565 missense unknown
R8314:Recql4 UTSW 15 76710180 missense probably damaging 1.00
R8480:Recql4 UTSW 15 76704505 missense probably benign 0.03
R8737:Recql4 UTSW 15 76708854 missense probably benign 0.00
R8789:Recql4 UTSW 15 76704346 missense probably benign
V7580:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
V7581:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
V7583:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGCAGCCAGAAGGTTTTGCC -3'
(R):5'- TCCCTGAGGCCAGAAGAAAG -3'

Sequencing Primer
(F):5'- CTGACAGTCAGTGATGGCCAC -3'
(R):5'- GCATCTTCCATGGCATTGG -3'
Posted On2019-10-07