Incidental Mutation 'R7653:Xdh'
ID 580517
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 045730-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R7653 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74204040 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1107 (F1107L)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably benign
Transcript: ENSMUST00000024866
AA Change: F1107L

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: F1107L

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik A T 6: 92,805,050 (GRCm39) Q70L unknown Het
Adamts12 T A 15: 11,257,115 (GRCm39) N489K probably benign Het
Alms1 A G 6: 85,597,577 (GRCm39) D801G possibly damaging Het
Apex1 T G 14: 51,163,995 (GRCm39) N173K probably damaging Het
Arhgap32 A T 9: 32,168,441 (GRCm39) N808I probably benign Het
Arhgef28 T C 13: 98,105,821 (GRCm39) Y706C probably benign Het
Atg2b A T 12: 105,602,731 (GRCm39) F1604Y possibly damaging Het
Atm A T 9: 53,401,602 (GRCm39) Y1422* probably null Het
Bace2 T A 16: 97,237,852 (GRCm39) V38E Het
Birc6 C A 17: 74,954,729 (GRCm39) L3442I possibly damaging Het
C6 T A 15: 4,844,244 (GRCm39) S889T Het
Calcrl A T 2: 84,175,529 (GRCm39) L275* probably null Het
Casp6 T C 3: 129,705,872 (GRCm39) Y180H probably benign Het
Cd5 T C 19: 10,703,910 (GRCm39) M51V probably benign Het
Cdhr1 G T 14: 36,804,158 (GRCm39) P500Q probably benign Het
Celsr3 G A 9: 108,712,269 (GRCm39) W1732* probably null Het
Ces2g T C 8: 105,689,285 (GRCm39) V87A probably damaging Het
Chil6 T C 3: 106,301,641 (GRCm39) N153S possibly damaging Het
Chrna5 A T 9: 54,909,718 (GRCm39) D113V probably benign Het
Cimip2b T G 4: 43,427,273 (GRCm39) probably null Het
Cox20 A G 1: 178,150,164 (GRCm39) T113A probably benign Het
Cryl1 T C 14: 57,541,148 (GRCm39) I179V probably benign Het
Dennd3 A G 15: 73,434,275 (GRCm39) T982A probably damaging Het
Drosha G A 15: 12,859,522 (GRCm39) V577I probably benign Het
Dync2h1 A G 9: 7,117,570 (GRCm39) S2240P probably benign Het
Eif1ad14 T A 12: 87,886,248 (GRCm39) D127V unknown Het
Fbxl5 C T 5: 43,916,116 (GRCm39) S432N probably benign Het
Fez1 T A 9: 36,772,146 (GRCm39) S150R probably benign Het
Gabrb2 T G 11: 42,378,039 (GRCm39) M85R probably damaging Het
Lhx4 A G 1: 155,580,617 (GRCm39) V203A probably damaging Het
Med23 G A 10: 24,780,282 (GRCm39) D977N probably damaging Het
Mplkip T C 13: 17,870,367 (GRCm39) F100L probably damaging Het
Ncoa7 C T 10: 30,570,239 (GRCm39) G240E probably damaging Het
Nedd4 A G 9: 72,650,910 (GRCm39) E827G probably damaging Het
Nfatc2 A G 2: 168,413,065 (GRCm39) F207L probably benign Het
Nr2f1 A T 13: 78,343,716 (GRCm39) S183T probably benign Het
Ocel1 A G 8: 71,824,560 (GRCm39) E81G probably benign Het
Or10aa3 T C 1: 173,878,488 (GRCm39) V183A probably benign Het
Or10g3b C A 14: 52,586,889 (GRCm39) G205* probably null Het
Or4n4b C T 14: 50,536,604 (GRCm39) G54E possibly damaging Het
Pcdh8 G A 14: 80,005,086 (GRCm39) P980S probably benign Het
Pex26 A T 6: 121,170,510 (GRCm39) Q285L possibly damaging Het
Pgap6 T A 17: 26,339,423 (GRCm39) M579K probably damaging Het
Plce1 A T 19: 38,737,763 (GRCm39) N1603I probably benign Het
Poli A T 18: 70,642,698 (GRCm39) C501S probably benign Het
Ppp4r4 C T 12: 103,550,404 (GRCm39) T276I probably damaging Het
Rbpj T A 5: 53,747,693 (GRCm39) M1K probably null Het
Recql4 T A 15: 76,587,982 (GRCm39) M1204L probably benign Het
Ribc2 T C 15: 85,025,876 (GRCm39) I284T probably benign Het
Rreb1 C A 13: 38,114,362 (GRCm39) Q574K probably benign Het
Scn9a A T 2: 66,357,424 (GRCm39) L959Q probably damaging Het
Shank1 C A 7: 43,969,093 (GRCm39) H329Q unknown Het
Soat2 A T 15: 102,071,013 (GRCm39) D469V probably damaging Het
Spag7 T A 11: 70,555,691 (GRCm39) H82L probably damaging Het
Sptb T C 12: 76,675,271 (GRCm39) I248V probably benign Het
Tacr3 A G 3: 134,566,843 (GRCm39) I239V probably benign Het
Tbc1d1 T C 5: 64,414,133 (GRCm39) F165L probably benign Het
Tchhl1 A G 3: 93,378,451 (GRCm39) E385G probably benign Het
Tecta C T 9: 42,248,532 (GRCm39) D1957N probably damaging Het
Tenm2 T C 11: 35,938,174 (GRCm39) I1501V probably benign Het
Tet2 G T 3: 133,192,146 (GRCm39) Q763K probably benign Het
Timd6 A C 11: 46,475,200 (GRCm39) S132R probably benign Het
Tox3 G A 8: 90,975,617 (GRCm39) T338I probably damaging Het
Usp30 G A 5: 114,259,730 (GRCm39) D479N probably damaging Het
Vmn1r27 T C 6: 58,192,785 (GRCm39) D73G possibly damaging Het
Vmn1r27 A T 6: 58,192,879 (GRCm39) S42T probably benign Het
Vmn2r120 A T 17: 57,816,258 (GRCm39) V699D possibly damaging Het
Vwa2 A T 19: 56,897,767 (GRCm39) T691S probably benign Het
Wdr31 T A 4: 62,381,666 (GRCm39) Q55L probably benign Het
Zfp184 A G 13: 22,143,887 (GRCm39) H531R probably damaging Het
Zfp366 T C 13: 99,365,709 (GRCm39) L290P probably damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTTACCCTGTGACTCAGACAG -3'
(R):5'- GGTGTCCATCAGAAGTTCCCTC -3'

Sequencing Primer
(F):5'- CAGAGCTCATTGTCTCCAAGTAGG -3'
(R):5'- TCTCTGTCAGCCTAGGCATGG -3'
Posted On 2019-10-07