Incidental Mutation 'R7436:Hspg2'
ID 580541
Institutional Source Beutler Lab
Gene Symbol Hspg2
Ensembl Gene ENSMUSG00000028763
Gene Name perlecan (heparan sulfate proteoglycan 2)
Synonyms Plc, per, perlecan, Pcn
MMRRC Submission 045512-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7436 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 137196080-137297941 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 137242975 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 702 (M702K)
Ref Sequence ENSEMBL: ENSMUSP00000131316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030547] [ENSMUST00000171332]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030547
AA Change: M702K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030547
Gene: ENSMUSG00000028763
AA Change: M702K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1113 1156 7.5e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2056 2117 4.81e-15 SMART
IGc2 2157 2216 1.37e-10 SMART
IGc2 2251 2312 5.88e-10 SMART
low complexity region 2333 2344 N/A INTRINSIC
IGc2 2347 2408 1.97e-11 SMART
IGc2 2441 2502 1.59e-15 SMART
low complexity region 2517 2528 N/A INTRINSIC
IGc2 2538 2599 3.08e-13 SMART
IGc2 2634 2695 9.25e-17 SMART
low complexity region 2704 2728 N/A INTRINSIC
IGc2 2731 2792 1.84e-11 SMART
IGc2 2828 2889 2.11e-11 SMART
IGc2 2926 2987 3.25e-12 SMART
IG 3017 3098 3.62e-10 SMART
IGc2 3114 3180 9.05e-11 SMART
IGc2 3212 3273 2.44e-16 SMART
IGc2 3299 3360 2.26e-11 SMART
IGc2 3400 3461 6.81e-6 SMART
IGc2 3489 3550 1.59e-15 SMART
IGc2 3575 3636 2.54e-14 SMART
LamG 3672 3813 3.41e-39 SMART
EGF 3832 3866 6.91e-9 SMART
EGF 3872 3907 4.46e-3 SMART
LamG 3934 4070 4.78e-43 SMART
EGF 4092 4126 1.17e-6 SMART
EGF 4131 4161 1.87e-5 SMART
LamG 4211 4348 1.33e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171332
AA Change: M702K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131316
Gene: ENSMUSG00000028763
AA Change: M702K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1114 1156 7.9e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2062 2123 4.81e-15 SMART
IGc2 2163 2222 1.37e-10 SMART
IGc2 2257 2318 5.88e-10 SMART
low complexity region 2339 2350 N/A INTRINSIC
IGc2 2353 2414 1.97e-11 SMART
IGc2 2447 2508 1.59e-15 SMART
low complexity region 2523 2534 N/A INTRINSIC
IGc2 2544 2605 3.08e-13 SMART
IGc2 2640 2701 9.25e-17 SMART
low complexity region 2710 2734 N/A INTRINSIC
IGc2 2737 2798 1.84e-11 SMART
IGc2 2836 2897 2.11e-11 SMART
IGc2 2934 2995 3.25e-12 SMART
IG 3025 3106 3.62e-10 SMART
IGc2 3122 3188 9.05e-11 SMART
IGc2 3220 3281 2.44e-16 SMART
IGc2 3307 3368 2.26e-11 SMART
IGc2 3408 3469 6.81e-6 SMART
IGc2 3497 3558 1.59e-15 SMART
IGc2 3583 3644 2.54e-14 SMART
LamG 3680 3821 3.41e-39 SMART
EGF 3840 3874 6.91e-9 SMART
EGF 3880 3915 4.46e-3 SMART
LamG 3942 4078 4.78e-43 SMART
EGF 4100 4134 1.17e-6 SMART
EGF 4139 4169 1.87e-5 SMART
LamG 4219 4356 1.33e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous targeted null mutants die either at embryonic day 10.5 with cardiac outflow defects and/or brain exencephaly or at birth with skeletal dysplasia including micromelia and craniofacial defects. An exon 3 deletion mutant shows only a lens defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik A G 14: 41,805,178 (GRCm39) probably null Het
2310034C09Rik A G 16: 88,556,242 (GRCm39) Y152C probably benign Het
Acads C A 5: 115,249,057 (GRCm39) Q365H probably damaging Het
Akap1 A G 11: 88,736,354 (GRCm39) S103P probably damaging Het
Ampd1 T A 3: 102,981,435 (GRCm39) probably null Het
Apoa1 T A 9: 46,141,100 (GRCm39) probably null Het
Asb16 A G 11: 102,163,481 (GRCm39) D157G possibly damaging Het
Bank1 T C 3: 135,761,561 (GRCm39) N748D possibly damaging Het
BC034090 C A 1: 155,102,127 (GRCm39) G46W probably damaging Het
Ccdc202 A T 14: 96,120,027 (GRCm39) K261N probably benign Het
Ccdc73 T A 2: 104,782,214 (GRCm39) V190E probably damaging Het
Cracd GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 77,004,801 (GRCm39) probably benign Het
Cyb561a3 A G 19: 10,559,696 (GRCm39) Y7C probably damaging Het
Cyp2t4 A T 7: 26,857,668 (GRCm39) D427V probably damaging Het
Cyp4f14 T C 17: 33,128,131 (GRCm39) T295A probably benign Het
D430041D05Rik T C 2: 104,087,447 (GRCm39) T510A probably benign Het
Dennd6a G T 14: 26,300,865 (GRCm39) E26* probably null Het
Dusp10 T C 1: 183,801,418 (GRCm39) I395T probably damaging Het
Dzip3 T A 16: 48,772,352 (GRCm39) H439L probably damaging Het
Heatr5b T A 17: 79,075,962 (GRCm39) D1452V probably benign Het
Hsd3b2 A G 3: 98,619,112 (GRCm39) F278L probably benign Het
Hydin T C 8: 111,310,546 (GRCm39) F4081L probably damaging Het
Ido1 T G 8: 25,076,932 (GRCm39) T209P probably benign Het
Ift122 C T 6: 115,903,263 (GRCm39) R1176C probably benign Het
Ipo8 T C 6: 148,691,303 (GRCm39) Y689C probably benign Het
Macf1 C T 4: 123,350,436 (GRCm39) R3809Q probably benign Het
Manea T C 4: 26,328,228 (GRCm39) Y271C probably damaging Het
Mroh2b A G 15: 4,971,036 (GRCm39) T1014A probably benign Het
Nek5 A G 8: 22,598,056 (GRCm39) F200L probably damaging Het
Nipal1 A G 5: 72,824,984 (GRCm39) I226V probably benign Het
Nipsnap3a A T 4: 52,994,159 (GRCm39) N80I probably damaging Het
Nmur1 G A 1: 86,314,100 (GRCm39) P389S probably benign Het
Or10d5 G T 9: 39,861,349 (GRCm39) C239* probably null Het
Or1p1 T C 11: 74,179,511 (GRCm39) L13P possibly damaging Het
Or8u10 T C 2: 85,915,251 (GRCm39) Y290C probably damaging Het
Patl2 A C 2: 121,958,006 (GRCm39) V84G probably benign Het
Pcdhb4 T C 18: 37,442,328 (GRCm39) V546A probably damaging Het
Phf20l1 G T 15: 66,469,599 (GRCm39) S168I possibly damaging Het
Phgdh T C 3: 98,247,045 (GRCm39) N35S probably benign Het
Pigw A T 11: 84,768,789 (GRCm39) M180K probably damaging Het
Pkhd1 G T 1: 20,270,925 (GRCm39) H3209Q probably benign Het
Plbd2 A G 5: 120,624,861 (GRCm39) F436L probably damaging Het
Plch2 T C 4: 155,068,553 (GRCm39) T1358A probably benign Het
Poll C T 19: 45,541,496 (GRCm39) V491M probably damaging Het
Polr1e A G 4: 45,024,553 (GRCm39) probably null Het
Ppp1r35 G A 5: 137,778,279 (GRCm39) W258* probably null Het
Ptpdc1 A T 13: 48,740,142 (GRCm39) F430I probably benign Het
Ptprh T C 7: 4,555,742 (GRCm39) E739G probably damaging Het
Ramp2 T C 11: 101,138,765 (GRCm39) V148A possibly damaging Het
Rapgef6 T C 11: 54,501,747 (GRCm39) probably null Het
Rbm5 A G 9: 107,627,593 (GRCm39) probably null Het
Rnf39 A T 17: 37,254,241 (GRCm39) S88C probably benign Het
Rpl12 A G 2: 32,853,836 (GRCm39) I155V probably benign Het
Scart2 A T 7: 139,841,520 (GRCm39) T275S probably benign Het
Senp5 C T 16: 31,794,847 (GRCm39) E596K unknown Het
Serpinb9d A G 13: 33,379,916 (GRCm39) Y85C probably benign Het
Serpinf1 T A 11: 75,307,142 (GRCm39) Y65F probably benign Het
Snrnp200 G A 2: 127,068,404 (GRCm39) probably null Het
Spatc1 A T 15: 76,152,568 (GRCm39) Q66L probably benign Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,345,211 (GRCm39) probably benign Het
Traf3ip1 A G 1: 91,439,110 (GRCm39) D342G probably benign Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ube2j2 T C 4: 156,041,788 (GRCm39) V249A probably damaging Het
Utrn A C 10: 12,315,535 (GRCm39) N3025K possibly damaging Het
Vmn1r17 T A 6: 57,337,862 (GRCm39) M168L probably benign Het
Vmn1r77 T A 7: 11,775,694 (GRCm39) S157T probably benign Het
Zfp977 A G 7: 42,229,884 (GRCm39) S214P probably benign Het
Zscan10 T C 17: 23,828,979 (GRCm39) L507P possibly damaging Het
Other mutations in Hspg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hspg2 APN 4 137,256,131 (GRCm39) missense probably damaging 1.00
IGL00339:Hspg2 APN 4 137,266,506 (GRCm39) missense probably damaging 1.00
IGL00943:Hspg2 APN 4 137,289,512 (GRCm39) missense probably benign 0.15
IGL00970:Hspg2 APN 4 137,269,901 (GRCm39) missense probably benign 0.09
IGL01011:Hspg2 APN 4 137,286,646 (GRCm39) missense probably damaging 1.00
IGL01148:Hspg2 APN 4 137,273,969 (GRCm39) missense probably benign 0.11
IGL01333:Hspg2 APN 4 137,267,625 (GRCm39) missense probably damaging 1.00
IGL01367:Hspg2 APN 4 137,265,800 (GRCm39) missense probably damaging 1.00
IGL01455:Hspg2 APN 4 137,281,128 (GRCm39) missense probably damaging 1.00
IGL01540:Hspg2 APN 4 137,247,017 (GRCm39) missense probably damaging 1.00
IGL01578:Hspg2 APN 4 137,266,494 (GRCm39) missense probably damaging 1.00
IGL01603:Hspg2 APN 4 137,280,114 (GRCm39) missense probably damaging 1.00
IGL01632:Hspg2 APN 4 137,242,084 (GRCm39) missense probably damaging 1.00
IGL01658:Hspg2 APN 4 137,292,237 (GRCm39) missense probably damaging 1.00
IGL01760:Hspg2 APN 4 137,239,982 (GRCm39) missense possibly damaging 0.60
IGL01976:Hspg2 APN 4 137,289,237 (GRCm39) missense probably damaging 1.00
IGL02024:Hspg2 APN 4 137,267,384 (GRCm39) missense probably damaging 1.00
IGL02033:Hspg2 APN 4 137,279,565 (GRCm39) missense probably benign
IGL02051:Hspg2 APN 4 137,295,700 (GRCm39) unclassified probably benign
IGL02124:Hspg2 APN 4 137,246,125 (GRCm39) splice site probably null
IGL02128:Hspg2 APN 4 137,291,327 (GRCm39) missense probably damaging 1.00
IGL02177:Hspg2 APN 4 137,242,627 (GRCm39) missense probably damaging 1.00
IGL02230:Hspg2 APN 4 137,245,956 (GRCm39) missense probably damaging 1.00
IGL02266:Hspg2 APN 4 137,237,888 (GRCm39) missense probably damaging 1.00
IGL02313:Hspg2 APN 4 137,235,700 (GRCm39) missense probably benign 0.03
IGL02477:Hspg2 APN 4 137,271,823 (GRCm39) splice site probably benign
IGL02514:Hspg2 APN 4 137,296,887 (GRCm39) missense probably benign 0.09
IGL02613:Hspg2 APN 4 137,271,731 (GRCm39) missense probably damaging 1.00
IGL02625:Hspg2 APN 4 137,239,953 (GRCm39) missense probably damaging 1.00
IGL02646:Hspg2 APN 4 137,279,159 (GRCm39) missense possibly damaging 0.60
IGL02651:Hspg2 APN 4 137,284,756 (GRCm39) splice site probably benign
IGL02701:Hspg2 APN 4 137,284,485 (GRCm39) missense probably damaging 0.96
IGL02833:Hspg2 APN 4 137,282,441 (GRCm39) missense probably benign 0.00
IGL02985:Hspg2 APN 4 137,235,114 (GRCm39) missense probably damaging 1.00
IGL03040:Hspg2 APN 4 137,289,136 (GRCm39) critical splice donor site probably null
IGL03181:Hspg2 APN 4 137,243,248 (GRCm39) missense probably damaging 1.00
IGL03349:Hspg2 APN 4 137,287,833 (GRCm39) splice site probably benign
G1patch:Hspg2 UTSW 4 137,242,618 (GRCm39) missense probably damaging 1.00
PIT4305001:Hspg2 UTSW 4 137,277,684 (GRCm39) missense possibly damaging 0.55
R0006:Hspg2 UTSW 4 137,247,242 (GRCm39) missense probably damaging 1.00
R0036:Hspg2 UTSW 4 137,270,160 (GRCm39) missense probably damaging 1.00
R0109:Hspg2 UTSW 4 137,289,512 (GRCm39) missense probably benign 0.15
R0131:Hspg2 UTSW 4 137,279,198 (GRCm39) missense probably damaging 1.00
R0131:Hspg2 UTSW 4 137,279,198 (GRCm39) missense probably damaging 1.00
R0132:Hspg2 UTSW 4 137,279,198 (GRCm39) missense probably damaging 1.00
R0245:Hspg2 UTSW 4 137,242,033 (GRCm39) missense probably damaging 1.00
R0388:Hspg2 UTSW 4 137,238,469 (GRCm39) missense probably damaging 1.00
R0389:Hspg2 UTSW 4 137,242,734 (GRCm39) missense possibly damaging 0.53
R0468:Hspg2 UTSW 4 137,260,840 (GRCm39) missense probably damaging 1.00
R0480:Hspg2 UTSW 4 137,277,335 (GRCm39) missense probably damaging 1.00
R0546:Hspg2 UTSW 4 137,229,605 (GRCm39) missense probably benign
R0599:Hspg2 UTSW 4 137,239,712 (GRCm39) missense probably damaging 0.98
R0652:Hspg2 UTSW 4 137,242,033 (GRCm39) missense probably damaging 1.00
R0671:Hspg2 UTSW 4 137,280,591 (GRCm39) missense probably damaging 1.00
R0760:Hspg2 UTSW 4 137,239,660 (GRCm39) missense probably damaging 1.00
R0883:Hspg2 UTSW 4 137,268,751 (GRCm39) missense probably benign 0.00
R1403:Hspg2 UTSW 4 137,267,411 (GRCm39) missense possibly damaging 0.90
R1417:Hspg2 UTSW 4 137,244,947 (GRCm39) missense probably benign
R1497:Hspg2 UTSW 4 137,275,407 (GRCm39) missense probably damaging 0.98
R1509:Hspg2 UTSW 4 137,238,552 (GRCm39) splice site probably benign
R1625:Hspg2 UTSW 4 137,246,282 (GRCm39) missense probably benign 0.23
R1630:Hspg2 UTSW 4 137,245,746 (GRCm39) missense probably damaging 1.00
R1651:Hspg2 UTSW 4 137,260,748 (GRCm39) nonsense probably null
R1699:Hspg2 UTSW 4 137,275,323 (GRCm39) splice site probably null
R1703:Hspg2 UTSW 4 137,286,462 (GRCm39) missense probably damaging 1.00
R1761:Hspg2 UTSW 4 137,241,984 (GRCm39) missense possibly damaging 0.90
R1775:Hspg2 UTSW 4 137,247,467 (GRCm39) missense probably damaging 0.99
R1779:Hspg2 UTSW 4 137,245,820 (GRCm39) missense probably damaging 1.00
R1843:Hspg2 UTSW 4 137,272,878 (GRCm39) missense probably damaging 1.00
R1891:Hspg2 UTSW 4 137,292,801 (GRCm39) missense probably damaging 1.00
R1930:Hspg2 UTSW 4 137,267,541 (GRCm39) missense probably damaging 1.00
R1931:Hspg2 UTSW 4 137,267,541 (GRCm39) missense probably damaging 1.00
R1942:Hspg2 UTSW 4 137,269,863 (GRCm39) missense possibly damaging 0.67
R1959:Hspg2 UTSW 4 137,292,206 (GRCm39) missense probably damaging 1.00
R2042:Hspg2 UTSW 4 137,295,677 (GRCm39) missense probably damaging 1.00
R2062:Hspg2 UTSW 4 137,286,678 (GRCm39) missense possibly damaging 0.79
R2098:Hspg2 UTSW 4 137,247,420 (GRCm39) missense probably damaging 1.00
R2158:Hspg2 UTSW 4 137,244,915 (GRCm39) missense probably damaging 1.00
R2280:Hspg2 UTSW 4 137,249,354 (GRCm39) missense probably damaging 1.00
R2890:Hspg2 UTSW 4 137,276,885 (GRCm39) missense probably damaging 1.00
R2927:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R3428:Hspg2 UTSW 4 137,282,601 (GRCm39) missense probably damaging 1.00
R3744:Hspg2 UTSW 4 137,292,815 (GRCm39) splice site probably benign
R3873:Hspg2 UTSW 4 137,266,660 (GRCm39) missense probably damaging 1.00
R3874:Hspg2 UTSW 4 137,266,660 (GRCm39) missense probably damaging 1.00
R3917:Hspg2 UTSW 4 137,286,625 (GRCm39) missense probably damaging 1.00
R3932:Hspg2 UTSW 4 137,242,879 (GRCm39) missense probably damaging 0.99
R3933:Hspg2 UTSW 4 137,242,879 (GRCm39) missense probably damaging 0.99
R4134:Hspg2 UTSW 4 137,283,968 (GRCm39) missense probably damaging 0.99
R4272:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4273:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4274:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4275:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4288:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4289:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4354:Hspg2 UTSW 4 137,196,222 (GRCm39) missense probably benign 0.17
R4355:Hspg2 UTSW 4 137,256,729 (GRCm39) missense probably damaging 0.98
R4400:Hspg2 UTSW 4 137,275,433 (GRCm39) missense probably benign 0.01
R4411:Hspg2 UTSW 4 137,289,535 (GRCm39) missense probably benign
R4421:Hspg2 UTSW 4 137,275,433 (GRCm39) missense probably benign 0.01
R4592:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137,266,886 (GRCm39) missense possibly damaging 0.80
R4612:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4619:Hspg2 UTSW 4 137,273,884 (GRCm39) missense probably damaging 1.00
R4658:Hspg2 UTSW 4 137,261,041 (GRCm39) missense probably damaging 1.00
R4667:Hspg2 UTSW 4 137,266,956 (GRCm39) missense possibly damaging 0.90
R4724:Hspg2 UTSW 4 137,249,438 (GRCm39) missense probably damaging 0.96
R4739:Hspg2 UTSW 4 137,297,384 (GRCm39) unclassified probably benign
R4793:Hspg2 UTSW 4 137,256,784 (GRCm39) missense possibly damaging 0.95
R4826:Hspg2 UTSW 4 137,292,706 (GRCm39) missense probably damaging 1.00
R4838:Hspg2 UTSW 4 137,268,977 (GRCm39) missense possibly damaging 0.53
R4896:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R4926:Hspg2 UTSW 4 137,269,841 (GRCm39) missense probably damaging 1.00
R4939:Hspg2 UTSW 4 137,235,342 (GRCm39) missense probably damaging 1.00
R5032:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R5033:Hspg2 UTSW 4 137,246,251 (GRCm39) missense probably damaging 1.00
R5071:Hspg2 UTSW 4 137,267,541 (GRCm39) missense probably damaging 1.00
R5072:Hspg2 UTSW 4 137,267,541 (GRCm39) missense probably damaging 1.00
R5114:Hspg2 UTSW 4 137,239,237 (GRCm39) missense probably damaging 1.00
R5177:Hspg2 UTSW 4 137,246,083 (GRCm39) missense probably damaging 1.00
R5223:Hspg2 UTSW 4 137,271,225 (GRCm39) missense probably damaging 1.00
R5433:Hspg2 UTSW 4 137,256,105 (GRCm39) splice site probably null
R5529:Hspg2 UTSW 4 137,279,139 (GRCm39) missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137,270,136 (GRCm39) missense probably benign 0.17
R5541:Hspg2 UTSW 4 137,247,862 (GRCm39) missense probably damaging 1.00
R5546:Hspg2 UTSW 4 137,275,485 (GRCm39) critical splice donor site probably null
R5728:Hspg2 UTSW 4 137,270,077 (GRCm39) missense possibly damaging 0.95
R5764:Hspg2 UTSW 4 137,289,032 (GRCm39) missense probably damaging 1.00
R5920:Hspg2 UTSW 4 137,281,093 (GRCm39) missense probably damaging 1.00
R5934:Hspg2 UTSW 4 137,246,083 (GRCm39) missense probably damaging 1.00
R6074:Hspg2 UTSW 4 137,268,046 (GRCm39) missense probably benign
R6164:Hspg2 UTSW 4 137,241,966 (GRCm39) missense possibly damaging 0.89
R6175:Hspg2 UTSW 4 137,296,829 (GRCm39) missense probably damaging 1.00
R6217:Hspg2 UTSW 4 137,267,559 (GRCm39) missense probably damaging 0.99
R6262:Hspg2 UTSW 4 137,246,997 (GRCm39) missense probably damaging 1.00
R6299:Hspg2 UTSW 4 137,272,016 (GRCm39) missense probably damaging 1.00
R6333:Hspg2 UTSW 4 137,289,266 (GRCm39) missense probably damaging 1.00
R6371:Hspg2 UTSW 4 137,269,006 (GRCm39) missense probably damaging 1.00
R6430:Hspg2 UTSW 4 137,266,707 (GRCm39) missense probably damaging 1.00
R6498:Hspg2 UTSW 4 137,235,112 (GRCm39) missense possibly damaging 0.46
R6522:Hspg2 UTSW 4 137,282,586 (GRCm39) missense probably damaging 1.00
R6680:Hspg2 UTSW 4 137,293,048 (GRCm39) missense probably benign 0.18
R6724:Hspg2 UTSW 4 137,242,618 (GRCm39) missense probably damaging 1.00
R6725:Hspg2 UTSW 4 137,242,618 (GRCm39) missense probably damaging 1.00
R6762:Hspg2 UTSW 4 137,279,114 (GRCm39) missense possibly damaging 0.83
R6785:Hspg2 UTSW 4 137,235,709 (GRCm39) missense probably damaging 0.99
R6788:Hspg2 UTSW 4 137,242,618 (GRCm39) missense probably damaging 1.00
R6931:Hspg2 UTSW 4 137,268,031 (GRCm39) missense probably damaging 1.00
R6959:Hspg2 UTSW 4 137,246,600 (GRCm39) missense probably benign 0.45
R6968:Hspg2 UTSW 4 137,262,467 (GRCm39) missense probably damaging 1.00
R6988:Hspg2 UTSW 4 137,256,201 (GRCm39) missense probably damaging 1.00
R7021:Hspg2 UTSW 4 137,269,580 (GRCm39) missense possibly damaging 0.69
R7089:Hspg2 UTSW 4 137,271,677 (GRCm39) missense possibly damaging 0.51
R7107:Hspg2 UTSW 4 137,237,963 (GRCm39) missense probably damaging 1.00
R7141:Hspg2 UTSW 4 137,279,427 (GRCm39) missense probably damaging 1.00
R7161:Hspg2 UTSW 4 137,242,030 (GRCm39) missense probably damaging 1.00
R7189:Hspg2 UTSW 4 137,260,872 (GRCm39) critical splice donor site probably null
R7238:Hspg2 UTSW 4 137,235,704 (GRCm39) missense probably damaging 1.00
R7253:Hspg2 UTSW 4 137,247,257 (GRCm39) missense probably benign 0.15
R7278:Hspg2 UTSW 4 137,278,436 (GRCm39) missense probably damaging 0.98
R7287:Hspg2 UTSW 4 137,256,867 (GRCm39) missense probably benign 0.00
R7390:Hspg2 UTSW 4 137,266,490 (GRCm39) missense probably damaging 1.00
R7479:Hspg2 UTSW 4 137,266,714 (GRCm39) missense probably benign 0.17
R7516:Hspg2 UTSW 4 137,269,931 (GRCm39) missense possibly damaging 0.94
R7540:Hspg2 UTSW 4 137,268,751 (GRCm39) missense possibly damaging 0.51
R7603:Hspg2 UTSW 4 137,284,503 (GRCm39) missense possibly damaging 0.91
R7603:Hspg2 UTSW 4 137,275,679 (GRCm39) missense probably damaging 1.00
R7625:Hspg2 UTSW 4 137,292,249 (GRCm39) missense probably damaging 1.00
R7696:Hspg2 UTSW 4 137,239,277 (GRCm39) missense possibly damaging 0.78
R7767:Hspg2 UTSW 4 137,239,177 (GRCm39) missense probably damaging 1.00
R7815:Hspg2 UTSW 4 137,239,775 (GRCm39) missense probably damaging 1.00
R7825:Hspg2 UTSW 4 137,286,160 (GRCm39) missense probably damaging 1.00
R7863:Hspg2 UTSW 4 137,292,135 (GRCm39) missense probably benign 0.03
R7885:Hspg2 UTSW 4 137,244,148 (GRCm39) missense probably damaging 1.00
R7899:Hspg2 UTSW 4 137,275,427 (GRCm39) missense possibly damaging 0.72
R7937:Hspg2 UTSW 4 137,278,243 (GRCm39) missense probably benign 0.01
R7975:Hspg2 UTSW 4 137,282,532 (GRCm39) missense probably benign 0.26
R8078:Hspg2 UTSW 4 137,235,333 (GRCm39) missense probably damaging 1.00
R8285:Hspg2 UTSW 4 137,239,974 (GRCm39) missense probably benign 0.18
R8314:Hspg2 UTSW 4 137,266,986 (GRCm39) missense probably benign 0.12
R8322:Hspg2 UTSW 4 137,246,290 (GRCm39) missense possibly damaging 0.88
R8323:Hspg2 UTSW 4 137,246,290 (GRCm39) missense possibly damaging 0.88
R8324:Hspg2 UTSW 4 137,246,290 (GRCm39) missense possibly damaging 0.88
R8341:Hspg2 UTSW 4 137,246,290 (GRCm39) missense possibly damaging 0.88
R8383:Hspg2 UTSW 4 137,271,681 (GRCm39) missense possibly damaging 0.66
R8425:Hspg2 UTSW 4 137,278,178 (GRCm39) nonsense probably null
R8491:Hspg2 UTSW 4 137,281,030 (GRCm39) missense probably benign 0.00
R8525:Hspg2 UTSW 4 137,266,759 (GRCm39) missense probably damaging 0.98
R8978:Hspg2 UTSW 4 137,291,341 (GRCm39) missense probably benign 0.09
R9152:Hspg2 UTSW 4 137,249,876 (GRCm39) missense possibly damaging 0.89
R9166:Hspg2 UTSW 4 137,270,185 (GRCm39) missense probably damaging 1.00
R9175:Hspg2 UTSW 4 137,256,657 (GRCm39) missense probably damaging 0.98
R9210:Hspg2 UTSW 4 137,289,790 (GRCm39) missense probably benign 0.05
R9221:Hspg2 UTSW 4 137,287,726 (GRCm39) missense possibly damaging 0.79
R9325:Hspg2 UTSW 4 137,265,552 (GRCm39) missense probably damaging 1.00
R9339:Hspg2 UTSW 4 137,278,480 (GRCm39) missense probably benign
R9340:Hspg2 UTSW 4 137,296,827 (GRCm39) missense probably damaging 1.00
R9358:Hspg2 UTSW 4 137,244,909 (GRCm39) missense probably damaging 1.00
R9451:Hspg2 UTSW 4 137,238,380 (GRCm39) missense probably damaging 1.00
R9534:Hspg2 UTSW 4 137,268,072 (GRCm39) missense probably benign
R9656:Hspg2 UTSW 4 137,279,196 (GRCm39) missense probably benign
R9664:Hspg2 UTSW 4 137,266,887 (GRCm39) missense probably benign 0.03
R9695:Hspg2 UTSW 4 137,265,701 (GRCm39) missense probably damaging 1.00
R9741:Hspg2 UTSW 4 137,239,962 (GRCm39) missense probably damaging 1.00
V5622:Hspg2 UTSW 4 137,261,049 (GRCm39) missense probably damaging 0.99
V5622:Hspg2 UTSW 4 137,261,049 (GRCm39) missense probably damaging 0.99
X0028:Hspg2 UTSW 4 137,277,702 (GRCm39) missense probably benign
Z1177:Hspg2 UTSW 4 137,295,684 (GRCm39) missense possibly damaging 0.64
Z1177:Hspg2 UTSW 4 137,291,829 (GRCm39) missense probably damaging 0.99
Z1177:Hspg2 UTSW 4 137,277,778 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTGAACCAGCGTCAGG -3'
(R):5'- TCTGTGGGGATAGGACCAAG -3'

Sequencing Primer
(F):5'- GTGAGTGGCACCAGAATCTC -3'
(R):5'- ACCAAGAGAACGGCTGC -3'
Posted On 2019-10-07