Incidental Mutation 'R7436:Ppp1r35'
ID580549
Institutional Source Beutler Lab
Gene Symbol Ppp1r35
Ensembl Gene ENSMUSG00000029725
Gene Nameprotein phosphatase 1, regulatory subunit 35
Synonyms2010007H12Rik, 2010011D20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7436 (G1)
Quality Score214.009
Status Validated
Chromosome5
Chromosomal Location137778849-137780110 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 137780017 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 258 (W258*)
Ref Sequence ENSEMBL: ENSMUSP00000031739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031739] [ENSMUST00000031740] [ENSMUST00000196022] [ENSMUST00000198929]
Predicted Effect probably null
Transcript: ENSMUST00000031739
AA Change: W258*
SMART Domains Protein: ENSMUSP00000031739
Gene: ENSMUSG00000029725
AA Change: W258*

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
Pfam:PPP1R35_C 107 255 1.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031740
SMART Domains Protein: ENSMUSP00000031740
Gene: ENSMUSG00000029726

DomainStartEndE-ValueType
low complexity region 14 19 N/A INTRINSIC
low complexity region 49 74 N/A INTRINSIC
low complexity region 115 121 N/A INTRINSIC
low complexity region 130 136 N/A INTRINSIC
low complexity region 234 254 N/A INTRINSIC
low complexity region 307 352 N/A INTRINSIC
low complexity region 355 376 N/A INTRINSIC
Pfam:Methyltransf_23 398 623 2.7e-14 PFAM
Pfam:PrmA 408 489 6.9e-6 PFAM
Pfam:Methyltransf_31 419 480 9.3e-9 PFAM
Pfam:Methyltransf_18 420 595 1.8e-13 PFAM
Pfam:Bin3 552 660 4.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126126
SMART Domains Protein: ENSMUSP00000114480
Gene: ENSMUSG00000029725

DomainStartEndE-ValueType
Pfam:PPP1R35_C 48 144 2.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132726
SMART Domains Protein: ENSMUSP00000118688
Gene: ENSMUSG00000029726

DomainStartEndE-ValueType
Pfam:Methyltransf_11 33 99 8e-6 PFAM
Pfam:Bin3 59 167 8.3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196022
Predicted Effect silent
Transcript: ENSMUST00000198929
SMART Domains Protein: ENSMUSP00000143182
Gene: ENSMUSG00000029725

DomainStartEndE-ValueType
low complexity region 66 77 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik A G 14: 41,983,221 probably null Het
2310034C09Rik A G 16: 88,759,354 Y152C probably benign Het
4921530L21Rik A T 14: 95,882,591 K261N probably benign Het
5830411N06Rik A T 7: 140,261,607 T275S probably benign Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Akap1 A G 11: 88,845,528 S103P probably damaging Het
Ampd1 T A 3: 103,074,119 probably null Het
Apoa1 T A 9: 46,229,802 probably null Het
Asb16 A G 11: 102,272,655 D157G possibly damaging Het
Bank1 T C 3: 136,055,800 N748D possibly damaging Het
BC034090 C A 1: 155,226,381 G46W probably damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Ccdc73 T A 2: 104,951,869 V190E probably damaging Het
Cyb561a3 A G 19: 10,582,332 Y7C probably damaging Het
Cyp2t4 A T 7: 27,158,243 D427V probably damaging Het
Cyp4f14 T C 17: 32,909,157 T295A probably benign Het
D430041D05Rik T C 2: 104,257,102 T510A probably benign Het
Dennd6a G T 14: 26,579,710 E26* probably null Het
Dusp10 T C 1: 184,069,221 I395T probably damaging Het
Dzip3 T A 16: 48,951,989 H439L probably damaging Het
Heatr5b T A 17: 78,768,533 D1452V probably benign Het
Hsd3b2 A G 3: 98,711,796 F278L probably benign Het
Hspg2 T A 4: 137,515,664 M702K probably damaging Het
Hydin T C 8: 110,583,914 F4081L probably damaging Het
Ido1 T G 8: 24,586,916 T209P probably benign Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ipo8 T C 6: 148,789,805 Y689C probably benign Het
Macf1 C T 4: 123,456,643 R3809Q probably benign Het
Manea T C 4: 26,328,228 Y271C probably damaging Het
Mroh2b A G 15: 4,941,554 T1014A probably benign Het
Nek5 A G 8: 22,108,040 F200L probably damaging Het
Nipal1 A G 5: 72,667,641 I226V probably benign Het
Nipsnap3a A T 4: 52,994,159 N80I probably damaging Het
Nmur1 G A 1: 86,386,378 P389S probably benign Het
Olfr1037 T C 2: 86,084,907 Y290C probably damaging Het
Olfr59 T C 11: 74,288,685 L13P possibly damaging Het
Olfr975 G T 9: 39,950,053 C239* probably null Het
Patl2 A C 2: 122,127,525 V84G probably benign Het
Pcdhb4 T C 18: 37,309,275 V546A probably damaging Het
Phf20l1 G T 15: 66,597,750 S168I possibly damaging Het
Phgdh T C 3: 98,339,729 N35S probably benign Het
Pigw A T 11: 84,877,963 M180K probably damaging Het
Pkhd1 G T 1: 20,200,701 H3209Q probably benign Het
Plbd2 A G 5: 120,486,796 F436L probably damaging Het
Plch2 T C 4: 154,984,096 T1358A probably benign Het
Poll C T 19: 45,553,057 V491M probably damaging Het
Polr1e A G 4: 45,024,553 probably null Het
Ptpdc1 A T 13: 48,586,666 F430I probably benign Het
Ptprh T C 7: 4,552,743 E739G probably damaging Het
Ramp2 T C 11: 101,247,939 V148A possibly damaging Het
Rapgef6 T C 11: 54,610,921 probably null Het
Rbm5 A G 9: 107,750,394 probably null Het
Rnf39 A T 17: 36,943,349 S88C probably benign Het
Rpl12 A G 2: 32,963,824 I155V probably benign Het
Senp5 C T 16: 31,976,029 E596K unknown Het
Serpinb9d A G 13: 33,195,933 Y85C probably benign Het
Serpinf1 T A 11: 75,416,316 Y65F probably benign Het
Snrnp200 G A 2: 127,226,484 probably null Het
Spatc1 A T 15: 76,268,368 Q66L probably benign Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,368,229 probably benign Het
Traf3ip1 A G 1: 91,511,388 D342G probably benign Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ube2j2 T C 4: 155,957,331 V249A probably damaging Het
Utrn A C 10: 12,439,791 N3025K possibly damaging Het
Vmn1r17 T A 6: 57,360,877 M168L probably benign Het
Vmn1r77 T A 7: 12,041,767 S157T probably benign Het
Zfp977 A G 7: 42,580,460 S214P probably benign Het
Zscan10 T C 17: 23,610,005 L507P possibly damaging Het
Other mutations in Ppp1r35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Ppp1r35 APN 5 137779537 missense probably damaging 0.98
IGL02015:Ppp1r35 APN 5 137780031 unclassified probably benign
R2091:Ppp1r35 UTSW 5 137779894 missense possibly damaging 0.61
R2155:Ppp1r35 UTSW 5 137780005 missense probably benign 0.01
R5249:Ppp1r35 UTSW 5 137779144 unclassified probably benign
R5264:Ppp1r35 UTSW 5 137780024 unclassified probably benign
R8206:Ppp1r35 UTSW 5 137780034 missense unknown
Z1177:Ppp1r35 UTSW 5 137778943 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCCACCTCGAGTGTAACCTG -3'
(R):5'- CACACTTGGGACAGTGCTTTC -3'

Sequencing Primer
(F):5'- GCTTCACCTTCCCATAGGAGG -3'
(R):5'- CTTTCCACTTGCCATGGGGG -3'
Posted On2019-10-07