Incidental Mutation 'R7436:Cyp2t4'
ID580556
Institutional Source Beutler Lab
Gene Symbol Cyp2t4
Ensembl Gene ENSMUSG00000078787
Gene Namecytochrome P450, family 2, subfamily t, polypeptide 4
SynonymsLOC384724
MMRRC Submission
Accession Numbers

Genbank: NM_001100184; MGI: 2686296

Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7436 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location27153714-27158668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27158243 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 427 (D427V)
Ref Sequence ENSEMBL: ENSMUSP00000126779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080058] [ENSMUST00000108382] [ENSMUST00000108385] [ENSMUST00000164093]
Predicted Effect probably benign
Transcript: ENSMUST00000080058
SMART Domains Protein: ENSMUSP00000078966
Gene: ENSMUSG00000058709

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:P4Hc 75 136 3e-14 BLAST
low complexity region 154 174 N/A INTRINSIC
P4Hc 201 387 9.71e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108382
SMART Domains Protein: ENSMUSP00000104019
Gene: ENSMUSG00000058709

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:P4Hc 75 136 3e-14 BLAST
low complexity region 154 174 N/A INTRINSIC
P4Hc 201 387 9.71e-44 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108385
AA Change: D419V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104022
Gene: ENSMUSG00000078787
AA Change: D419V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 35 492 5.3e-130 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164093
AA Change: D427V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126779
Gene: ENSMUSG00000078787
AA Change: D427V

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:p450 43 500 2.6e-130 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik A G 14: 41,983,221 probably null Het
2310034C09Rik A G 16: 88,759,354 Y152C probably benign Het
4921530L21Rik A T 14: 95,882,591 K261N probably benign Het
5830411N06Rik A T 7: 140,261,607 T275S probably benign Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Akap1 A G 11: 88,845,528 S103P probably damaging Het
Ampd1 T A 3: 103,074,119 probably null Het
Apoa1 T A 9: 46,229,802 probably null Het
Asb16 A G 11: 102,272,655 D157G possibly damaging Het
Bank1 T C 3: 136,055,800 N748D possibly damaging Het
BC034090 C A 1: 155,226,381 G46W probably damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Ccdc73 T A 2: 104,951,869 V190E probably damaging Het
Cyb561a3 A G 19: 10,582,332 Y7C probably damaging Het
Cyp4f14 T C 17: 32,909,157 T295A probably benign Het
D430041D05Rik T C 2: 104,257,102 T510A probably benign Het
Dennd6a G T 14: 26,579,710 E26* probably null Het
Dusp10 T C 1: 184,069,221 I395T probably damaging Het
Dzip3 T A 16: 48,951,989 H439L probably damaging Het
Heatr5b T A 17: 78,768,533 D1452V probably benign Het
Hsd3b2 A G 3: 98,711,796 F278L probably benign Het
Hspg2 T A 4: 137,515,664 M702K probably damaging Het
Hydin T C 8: 110,583,914 F4081L probably damaging Het
Ido1 T G 8: 24,586,916 T209P probably benign Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ipo8 T C 6: 148,789,805 Y689C probably benign Het
Macf1 C T 4: 123,456,643 R3809Q probably benign Het
Manea T C 4: 26,328,228 Y271C probably damaging Het
Mroh2b A G 15: 4,941,554 T1014A probably benign Het
Nek5 A G 8: 22,108,040 F200L probably damaging Het
Nipal1 A G 5: 72,667,641 I226V probably benign Het
Nipsnap3a A T 4: 52,994,159 N80I probably damaging Het
Nmur1 G A 1: 86,386,378 P389S probably benign Het
Olfr1037 T C 2: 86,084,907 Y290C probably damaging Het
Olfr59 T C 11: 74,288,685 L13P possibly damaging Het
Olfr975 G T 9: 39,950,053 C239* probably null Het
Patl2 A C 2: 122,127,525 V84G probably benign Het
Pcdhb4 T C 18: 37,309,275 V546A probably damaging Het
Phf20l1 G T 15: 66,597,750 S168I possibly damaging Het
Phgdh T C 3: 98,339,729 N35S probably benign Het
Pigw A T 11: 84,877,963 M180K probably damaging Het
Pkhd1 G T 1: 20,200,701 H3209Q probably benign Het
Plbd2 A G 5: 120,486,796 F436L probably damaging Het
Plch2 T C 4: 154,984,096 T1358A probably benign Het
Poll C T 19: 45,553,057 V491M probably damaging Het
Polr1e A G 4: 45,024,553 probably null Het
Ppp1r35 G A 5: 137,780,017 W258* probably null Het
Ptpdc1 A T 13: 48,586,666 F430I probably benign Het
Ptprh T C 7: 4,552,743 E739G probably damaging Het
Ramp2 T C 11: 101,247,939 V148A possibly damaging Het
Rapgef6 T C 11: 54,610,921 probably null Het
Rbm5 A G 9: 107,750,394 probably null Het
Rnf39 A T 17: 36,943,349 S88C probably benign Het
Rpl12 A G 2: 32,963,824 I155V probably benign Het
Senp5 C T 16: 31,976,029 E596K unknown Het
Serpinb9d A G 13: 33,195,933 Y85C probably benign Het
Serpinf1 T A 11: 75,416,316 Y65F probably benign Het
Snrnp200 G A 2: 127,226,484 probably null Het
Spatc1 A T 15: 76,268,368 Q66L probably benign Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,368,229 probably benign Het
Traf3ip1 A G 1: 91,511,388 D342G probably benign Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ube2j2 T C 4: 155,957,331 V249A probably damaging Het
Utrn A C 10: 12,439,791 N3025K possibly damaging Het
Vmn1r17 T A 6: 57,360,877 M168L probably benign Het
Vmn1r77 T A 7: 12,041,767 S157T probably benign Het
Zfp977 A G 7: 42,580,460 S214P probably benign Het
Zscan10 T C 17: 23,610,005 L507P possibly damaging Het
Other mutations in Cyp2t4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Cyp2t4 APN 7 27155298 missense probably benign 0.00
IGL00706:Cyp2t4 APN 7 27155158 missense probably benign 0.01
IGL02926:Cyp2t4 APN 7 27157803 missense probably damaging 1.00
R0560:Cyp2t4 UTSW 7 27158511 missense probably damaging 0.99
R0632:Cyp2t4 UTSW 7 27158246 missense possibly damaging 0.82
R0788:Cyp2t4 UTSW 7 27155163 missense probably null
R1353:Cyp2t4 UTSW 7 27156630 missense probably benign 0.03
R1652:Cyp2t4 UTSW 7 27157390 missense possibly damaging 0.48
R1838:Cyp2t4 UTSW 7 27158416 missense possibly damaging 0.92
R1997:Cyp2t4 UTSW 7 27157613 critical splice donor site probably null
R2136:Cyp2t4 UTSW 7 27158160 missense probably benign 0.32
R2963:Cyp2t4 UTSW 7 27155274 missense possibly damaging 0.86
R6239:Cyp2t4 UTSW 7 27157475 missense possibly damaging 0.73
R6634:Cyp2t4 UTSW 7 27155788 nonsense probably null
R7251:Cyp2t4 UTSW 7 27157719 missense possibly damaging 0.72
R7348:Cyp2t4 UTSW 7 27157251 missense probably benign 0.01
R8350:Cyp2t4 UTSW 7 27157381 missense possibly damaging 0.51
R8352:Cyp2t4 UTSW 7 27157737 missense probably benign 0.04
Z1088:Cyp2t4 UTSW 7 27157746 missense probably damaging 1.00
Z1177:Cyp2t4 UTSW 7 27158240 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGGGCTAACACAACCAG -3'
(R):5'- CCGTCAGGAAGAGGAAGATCTC -3'

Sequencing Primer
(F):5'- ATGTGAGATCACTTGCCCAG -3'
(R):5'- TCAGGAAGAGGAAGATCTCGGAAC -3'
Posted On2019-10-07