Incidental Mutation 'R7436:Ptpdc1'
ID 580572
Institutional Source Beutler Lab
Gene Symbol Ptpdc1
Ensembl Gene ENSMUSG00000038042
Gene Name protein tyrosine phosphatase domain containing 1
Synonyms
MMRRC Submission 045512-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7436 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 48731348-48779140 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 48740142 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 430 (F430I)
Ref Sequence ENSEMBL: ENSMUSP00000152771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035824] [ENSMUST00000222028] [ENSMUST00000223025]
AlphaFold Q6NZK8
Predicted Effect probably benign
Transcript: ENSMUST00000035824
AA Change: F369I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000047374
Gene: ENSMUSG00000038042
AA Change: F369I

DomainStartEndE-ValueType
Pfam:DSPc 102 243 1.1e-13 PFAM
Pfam:Y_phosphatase 144 242 8.9e-10 PFAM
low complexity region 598 610 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222028
AA Change: F430I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000223025
Meta Mutation Damage Score 0.0680 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: The protein encoded by this gene is a centrosomal mitotic phosphatase. This protein has been implicated in centrosomal duplication and cytokinesis. In addition, knockdown of expression levels in non-cycling cells results in extra long cilia, suggesting that this protein may function in regulating cilia length independent of a function in cell cycle control. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik A G 14: 41,805,178 (GRCm39) probably null Het
2310034C09Rik A G 16: 88,556,242 (GRCm39) Y152C probably benign Het
Acads C A 5: 115,249,057 (GRCm39) Q365H probably damaging Het
Akap1 A G 11: 88,736,354 (GRCm39) S103P probably damaging Het
Ampd1 T A 3: 102,981,435 (GRCm39) probably null Het
Apoa1 T A 9: 46,141,100 (GRCm39) probably null Het
Asb16 A G 11: 102,163,481 (GRCm39) D157G possibly damaging Het
Bank1 T C 3: 135,761,561 (GRCm39) N748D possibly damaging Het
BC034090 C A 1: 155,102,127 (GRCm39) G46W probably damaging Het
Ccdc202 A T 14: 96,120,027 (GRCm39) K261N probably benign Het
Ccdc73 T A 2: 104,782,214 (GRCm39) V190E probably damaging Het
Cracd GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 77,004,801 (GRCm39) probably benign Het
Cyb561a3 A G 19: 10,559,696 (GRCm39) Y7C probably damaging Het
Cyp2t4 A T 7: 26,857,668 (GRCm39) D427V probably damaging Het
Cyp4f14 T C 17: 33,128,131 (GRCm39) T295A probably benign Het
D430041D05Rik T C 2: 104,087,447 (GRCm39) T510A probably benign Het
Dennd6a G T 14: 26,300,865 (GRCm39) E26* probably null Het
Dusp10 T C 1: 183,801,418 (GRCm39) I395T probably damaging Het
Dzip3 T A 16: 48,772,352 (GRCm39) H439L probably damaging Het
Heatr5b T A 17: 79,075,962 (GRCm39) D1452V probably benign Het
Hsd3b2 A G 3: 98,619,112 (GRCm39) F278L probably benign Het
Hspg2 T A 4: 137,242,975 (GRCm39) M702K probably damaging Het
Hydin T C 8: 111,310,546 (GRCm39) F4081L probably damaging Het
Ido1 T G 8: 25,076,932 (GRCm39) T209P probably benign Het
Ift122 C T 6: 115,903,263 (GRCm39) R1176C probably benign Het
Ipo8 T C 6: 148,691,303 (GRCm39) Y689C probably benign Het
Macf1 C T 4: 123,350,436 (GRCm39) R3809Q probably benign Het
Manea T C 4: 26,328,228 (GRCm39) Y271C probably damaging Het
Mroh2b A G 15: 4,971,036 (GRCm39) T1014A probably benign Het
Nek5 A G 8: 22,598,056 (GRCm39) F200L probably damaging Het
Nipal1 A G 5: 72,824,984 (GRCm39) I226V probably benign Het
Nipsnap3a A T 4: 52,994,159 (GRCm39) N80I probably damaging Het
Nmur1 G A 1: 86,314,100 (GRCm39) P389S probably benign Het
Or10d5 G T 9: 39,861,349 (GRCm39) C239* probably null Het
Or1p1 T C 11: 74,179,511 (GRCm39) L13P possibly damaging Het
Or8u10 T C 2: 85,915,251 (GRCm39) Y290C probably damaging Het
Patl2 A C 2: 121,958,006 (GRCm39) V84G probably benign Het
Pcdhb4 T C 18: 37,442,328 (GRCm39) V546A probably damaging Het
Phf20l1 G T 15: 66,469,599 (GRCm39) S168I possibly damaging Het
Phgdh T C 3: 98,247,045 (GRCm39) N35S probably benign Het
Pigw A T 11: 84,768,789 (GRCm39) M180K probably damaging Het
Pkhd1 G T 1: 20,270,925 (GRCm39) H3209Q probably benign Het
Plbd2 A G 5: 120,624,861 (GRCm39) F436L probably damaging Het
Plch2 T C 4: 155,068,553 (GRCm39) T1358A probably benign Het
Poll C T 19: 45,541,496 (GRCm39) V491M probably damaging Het
Polr1e A G 4: 45,024,553 (GRCm39) probably null Het
Ppp1r35 G A 5: 137,778,279 (GRCm39) W258* probably null Het
Ptprh T C 7: 4,555,742 (GRCm39) E739G probably damaging Het
Ramp2 T C 11: 101,138,765 (GRCm39) V148A possibly damaging Het
Rapgef6 T C 11: 54,501,747 (GRCm39) probably null Het
Rbm5 A G 9: 107,627,593 (GRCm39) probably null Het
Rnf39 A T 17: 37,254,241 (GRCm39) S88C probably benign Het
Rpl12 A G 2: 32,853,836 (GRCm39) I155V probably benign Het
Scart2 A T 7: 139,841,520 (GRCm39) T275S probably benign Het
Senp5 C T 16: 31,794,847 (GRCm39) E596K unknown Het
Serpinb9d A G 13: 33,379,916 (GRCm39) Y85C probably benign Het
Serpinf1 T A 11: 75,307,142 (GRCm39) Y65F probably benign Het
Snrnp200 G A 2: 127,068,404 (GRCm39) probably null Het
Spatc1 A T 15: 76,152,568 (GRCm39) Q66L probably benign Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,345,211 (GRCm39) probably benign Het
Traf3ip1 A G 1: 91,439,110 (GRCm39) D342G probably benign Het
Txk T A 5: 72,853,922 (GRCm39) T472S probably damaging Het
Ube2j2 T C 4: 156,041,788 (GRCm39) V249A probably damaging Het
Utrn A C 10: 12,315,535 (GRCm39) N3025K possibly damaging Het
Vmn1r17 T A 6: 57,337,862 (GRCm39) M168L probably benign Het
Vmn1r77 T A 7: 11,775,694 (GRCm39) S157T probably benign Het
Zfp977 A G 7: 42,229,884 (GRCm39) S214P probably benign Het
Zscan10 T C 17: 23,828,979 (GRCm39) L507P possibly damaging Het
Other mutations in Ptpdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Ptpdc1 APN 13 48,740,534 (GRCm39) missense possibly damaging 0.80
IGL01410:Ptpdc1 APN 13 48,740,080 (GRCm39) missense probably damaging 0.99
IGL02931:Ptpdc1 APN 13 48,744,095 (GRCm39) splice site probably benign
IGL03180:Ptpdc1 APN 13 48,739,553 (GRCm39) missense probably damaging 1.00
PIT4519001:Ptpdc1 UTSW 13 48,736,632 (GRCm39) missense probably benign 0.29
PIT4687001:Ptpdc1 UTSW 13 48,739,766 (GRCm39) missense probably benign 0.15
R0014:Ptpdc1 UTSW 13 48,740,395 (GRCm39) nonsense probably null
R0244:Ptpdc1 UTSW 13 48,739,456 (GRCm39) missense probably benign 0.00
R0420:Ptpdc1 UTSW 13 48,742,595 (GRCm39) critical splice donor site probably null
R0690:Ptpdc1 UTSW 13 48,740,381 (GRCm39) missense probably benign 0.33
R0946:Ptpdc1 UTSW 13 48,740,286 (GRCm39) missense probably damaging 1.00
R1076:Ptpdc1 UTSW 13 48,740,286 (GRCm39) missense probably damaging 1.00
R1387:Ptpdc1 UTSW 13 48,739,796 (GRCm39) missense possibly damaging 0.85
R1459:Ptpdc1 UTSW 13 48,740,173 (GRCm39) missense possibly damaging 0.62
R1688:Ptpdc1 UTSW 13 48,739,700 (GRCm39) missense probably benign 0.28
R1732:Ptpdc1 UTSW 13 48,740,021 (GRCm39) missense probably benign 0.00
R2097:Ptpdc1 UTSW 13 48,746,135 (GRCm39) critical splice acceptor site probably null
R2570:Ptpdc1 UTSW 13 48,739,539 (GRCm39) missense probably benign 0.02
R3950:Ptpdc1 UTSW 13 48,742,670 (GRCm39) missense probably damaging 1.00
R4260:Ptpdc1 UTSW 13 48,733,234 (GRCm39) missense probably benign 0.33
R5194:Ptpdc1 UTSW 13 48,740,265 (GRCm39) missense possibly damaging 0.91
R5271:Ptpdc1 UTSW 13 48,744,174 (GRCm39) missense probably damaging 1.00
R5894:Ptpdc1 UTSW 13 48,743,798 (GRCm39) missense probably damaging 1.00
R5934:Ptpdc1 UTSW 13 48,739,845 (GRCm39) missense probably benign 0.08
R6894:Ptpdc1 UTSW 13 48,744,114 (GRCm39) missense probably benign 0.21
R7056:Ptpdc1 UTSW 13 48,740,466 (GRCm39) missense possibly damaging 0.65
R7719:Ptpdc1 UTSW 13 48,739,766 (GRCm39) missense probably benign 0.15
R7827:Ptpdc1 UTSW 13 48,733,264 (GRCm39) missense probably damaging 1.00
R7969:Ptpdc1 UTSW 13 48,740,577 (GRCm39) missense probably damaging 1.00
R7986:Ptpdc1 UTSW 13 48,746,046 (GRCm39) missense probably damaging 1.00
R8330:Ptpdc1 UTSW 13 48,751,390 (GRCm39) missense probably benign 0.00
R8500:Ptpdc1 UTSW 13 48,739,759 (GRCm39) nonsense probably null
R8687:Ptpdc1 UTSW 13 48,740,136 (GRCm39) missense possibly damaging 0.90
R8874:Ptpdc1 UTSW 13 48,744,168 (GRCm39) missense probably damaging 1.00
R9130:Ptpdc1 UTSW 13 48,739,655 (GRCm39) missense probably benign 0.04
R9284:Ptpdc1 UTSW 13 48,740,167 (GRCm39) missense probably benign 0.04
R9290:Ptpdc1 UTSW 13 48,740,221 (GRCm39) missense probably benign 0.02
R9309:Ptpdc1 UTSW 13 48,736,607 (GRCm39) missense probably benign 0.00
R9359:Ptpdc1 UTSW 13 48,740,030 (GRCm39) missense probably benign 0.38
R9369:Ptpdc1 UTSW 13 48,736,722 (GRCm39) missense possibly damaging 0.95
R9661:Ptpdc1 UTSW 13 48,739,610 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GCTTCTGATGCTGGAGACTG -3'
(R):5'- AACTGCTGCTTGACTTGGCTG -3'

Sequencing Primer
(F):5'- GACTGTGGTCTAGCAACTCCTG -3'
(R):5'- CTGCTTGACTTGGCTGAGAACC -3'
Posted On 2019-10-07