Incidental Mutation 'R7436:Phf20l1'
ID580576
Institutional Source Beutler Lab
Gene Symbol Phf20l1
Ensembl Gene ENSMUSG00000072501
Gene NamePHD finger protein 20-like 1
SynonymsCGI-72, E130113K22Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R7436 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location66577560-66647976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 66597750 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 168 (S168I)
Ref Sequence ENSEMBL: ENSMUSP00000035682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230882] [ENSMUST00000230948]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048188
AA Change: S168I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: S168I

DomainStartEndE-ValueType
TUDOR 11 71 7.67e0 SMART
Agenet 11 73 3.53e0 SMART
Agenet 85 141 4.54e-1 SMART
TUDOR 85 141 5.75e-8 SMART
Pfam:DUF3776 210 319 1.3e-31 PFAM
Pfam:PHD20L1_u1 318 413 4.7e-47 PFAM
low complexity region 443 453 N/A INTRINSIC
low complexity region 530 543 N/A INTRINSIC
low complexity region 547 585 N/A INTRINSIC
low complexity region 598 608 N/A INTRINSIC
low complexity region 642 658 N/A INTRINSIC
PHD 683 727 8.45e-3 SMART
low complexity region 879 887 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229160
AA Change: S168I

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000229576
AA Change: S168I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230882
AA Change: S168I

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000230948
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A G 16: 88,759,354 Y152C probably benign Het
4921530L21Rik A T 14: 95,882,591 K261N probably benign Het
5830411N06Rik A T 7: 140,261,607 T275S probably benign Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Akap1 A G 11: 88,845,528 S103P probably damaging Het
Ampd1 T A 3: 103,074,119 probably null Het
Asb16 A G 11: 102,272,655 D157G possibly damaging Het
Bank1 T C 3: 136,055,800 N748D possibly damaging Het
BC034090 C A 1: 155,226,381 G46W probably damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Ccdc73 T A 2: 104,951,869 V190E probably damaging Het
Cyb561a3 A G 19: 10,582,332 Y7C probably damaging Het
Cyp2t4 A T 7: 27,158,243 D427V probably damaging Het
Cyp4f14 T C 17: 32,909,157 T295A probably benign Het
D430041D05Rik T C 2: 104,257,102 T510A probably benign Het
Dennd6a G T 14: 26,579,710 E26* probably null Het
Dusp10 T C 1: 184,069,221 I395T probably damaging Het
Dzip3 T A 16: 48,951,989 H439L probably damaging Het
Heatr5b T A 17: 78,768,533 D1452V probably benign Het
Hsd3b2 A G 3: 98,711,796 F278L probably benign Het
Hspg2 T A 4: 137,515,664 M702K probably damaging Het
Hydin T C 8: 110,583,914 F4081L probably damaging Het
Ido1 T G 8: 24,586,916 T209P probably benign Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ipo8 T C 6: 148,789,805 Y689C probably benign Het
Macf1 C T 4: 123,456,643 R3809Q probably benign Het
Manea T C 4: 26,328,228 Y271C probably damaging Het
Mroh2b A G 15: 4,941,554 T1014A probably benign Het
Nek5 A G 8: 22,108,040 F200L probably damaging Het
Nipal1 A G 5: 72,667,641 I226V probably benign Het
Nipsnap3a A T 4: 52,994,159 N80I probably damaging Het
Nmur1 G A 1: 86,386,378 P389S probably benign Het
Olfr1037 T C 2: 86,084,907 Y290C probably damaging Het
Olfr59 T C 11: 74,288,685 L13P possibly damaging Het
Olfr975 G T 9: 39,950,053 C239* probably null Het
Patl2 A C 2: 122,127,525 V84G probably benign Het
Pcdhb4 T C 18: 37,309,275 V546A probably damaging Het
Phgdh T C 3: 98,339,729 N35S probably benign Het
Pigw A T 11: 84,877,963 M180K probably damaging Het
Pkhd1 G T 1: 20,200,701 H3209Q probably benign Het
Plbd2 A G 5: 120,486,796 F436L probably damaging Het
Plch2 T C 4: 154,984,096 T1358A probably benign Het
Poll C T 19: 45,553,057 V491M probably damaging Het
Ppp1r35 G A 5: 137,780,017 W258* probably null Het
Ptpdc1 A T 13: 48,586,666 F430I probably benign Het
Ptprh T C 7: 4,552,743 E739G probably damaging Het
Ramp2 T C 11: 101,247,939 V148A possibly damaging Het
Rapgef6 T C 11: 54,610,921 probably null Het
Rnf39 A T 17: 36,943,349 S88C probably benign Het
Rpl12 A G 2: 32,963,824 I155V probably benign Het
Senp5 C T 16: 31,976,029 E596K unknown Het
Serpinb9d A G 13: 33,195,933 Y85C probably benign Het
Serpinf1 T A 11: 75,416,316 Y65F probably benign Het
Snrnp200 G A 2: 127,226,484 probably null Het
Spatc1 A T 15: 76,268,368 Q66L probably benign Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,368,229 probably benign Het
Traf3ip1 A G 1: 91,511,388 D342G probably benign Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ube2j2 T C 4: 155,957,331 V249A probably damaging Het
Utrn A C 10: 12,439,791 N3025K possibly damaging Het
Vmn1r17 T A 6: 57,360,877 M168L probably benign Het
Vmn1r77 T A 7: 12,041,767 S157T probably benign Het
Zfp977 A G 7: 42,580,460 S214P probably benign Het
Zscan10 T C 17: 23,610,005 L507P possibly damaging Het
Other mutations in Phf20l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Phf20l1 APN 15 66629035 missense probably benign 0.28
IGL00484:Phf20l1 APN 15 66615633 splice site probably benign
IGL00668:Phf20l1 APN 15 66632849 missense probably damaging 0.99
IGL00849:Phf20l1 APN 15 66636832 missense probably benign 0.00
IGL00954:Phf20l1 APN 15 66641908 missense probably damaging 1.00
IGL01025:Phf20l1 APN 15 66613132 missense probably damaging 1.00
IGL01504:Phf20l1 APN 15 66597691 missense possibly damaging 0.73
IGL02087:Phf20l1 APN 15 66628991 missense probably damaging 1.00
IGL02273:Phf20l1 APN 15 66640025 missense probably damaging 1.00
IGL02276:Phf20l1 APN 15 66615410 critical splice donor site probably null
IGL02372:Phf20l1 APN 15 66641801 missense probably damaging 1.00
IGL02589:Phf20l1 APN 15 66615632 splice site probably benign
IGL02656:Phf20l1 APN 15 66629827 missense probably damaging 1.00
IGL02691:Phf20l1 APN 15 66604864 missense probably damaging 1.00
IGL02881:Phf20l1 APN 15 66594980 critical splice donor site probably null
IGL02940:Phf20l1 APN 15 66595151 missense probably damaging 1.00
IGL02943:Phf20l1 APN 15 66594884 missense probably damaging 1.00
IGL03030:Phf20l1 APN 15 66641947 utr 3 prime probably benign
IGL03034:Phf20l1 APN 15 66597403 missense probably damaging 1.00
PIT4305001:Phf20l1 UTSW 15 66613052 missense possibly damaging 0.94
R0070:Phf20l1 UTSW 15 66639991 missense probably damaging 1.00
R0070:Phf20l1 UTSW 15 66639991 missense probably damaging 1.00
R0562:Phf20l1 UTSW 15 66609604 missense probably damaging 1.00
R0605:Phf20l1 UTSW 15 66595122 missense probably damaging 1.00
R0787:Phf20l1 UTSW 15 66615630 splice site probably benign
R1458:Phf20l1 UTSW 15 66604813 missense probably damaging 1.00
R1619:Phf20l1 UTSW 15 66615259 missense possibly damaging 0.88
R1781:Phf20l1 UTSW 15 66632825 missense probably damaging 1.00
R2360:Phf20l1 UTSW 15 66594920 missense probably damaging 1.00
R3973:Phf20l1 UTSW 15 66641816 missense probably damaging 1.00
R4374:Phf20l1 UTSW 15 66604837 missense possibly damaging 0.72
R4375:Phf20l1 UTSW 15 66615222 missense probably benign 0.00
R4554:Phf20l1 UTSW 15 66597367 missense probably damaging 1.00
R4913:Phf20l1 UTSW 15 66604855 missense probably benign 0.03
R5092:Phf20l1 UTSW 15 66636913 missense possibly damaging 0.46
R5491:Phf20l1 UTSW 15 66615785 missense possibly damaging 0.67
R5713:Phf20l1 UTSW 15 66636820 missense possibly damaging 0.85
R6126:Phf20l1 UTSW 15 66636824 missense probably benign 0.02
R6213:Phf20l1 UTSW 15 66632903 critical splice donor site probably null
R6569:Phf20l1 UTSW 15 66629824 missense probably damaging 1.00
R6572:Phf20l1 UTSW 15 66609547 missense probably damaging 1.00
R6808:Phf20l1 UTSW 15 66630913 missense probably damaging 0.99
R7100:Phf20l1 UTSW 15 66604840 missense probably benign 0.01
R7208:Phf20l1 UTSW 15 66604789 missense probably benign 0.05
R7466:Phf20l1 UTSW 15 66636884 missense probably damaging 1.00
R7604:Phf20l1 UTSW 15 66604084 missense probably benign 0.02
X0065:Phf20l1 UTSW 15 66597678 missense probably damaging 0.99
X0065:Phf20l1 UTSW 15 66629806 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGAGCCCCAAATAGCAGC -3'
(R):5'- TATGCTACTCAGAGAGCCCTATCTG -3'

Sequencing Primer
(F):5'- GCCCCAAATAGCAGCAAGAAAGAG -3'
(R):5'- TATCTGAAACAGCCTACAGAGTGTC -3'
Posted On2019-10-07