Incidental Mutation 'R7436:Dzip3'
ID580579
Institutional Source Beutler Lab
Gene Symbol Dzip3
Ensembl Gene ENSMUSG00000064061
Gene NameDAZ interacting protein 3, zinc finger
Synonyms2A-HUB, 6430549P11Rik, 2310047C04Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7436 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location48924232-48994165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48951989 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 439 (H439L)
Ref Sequence ENSEMBL: ENSMUSP00000113344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]
Predicted Effect probably benign
Transcript: ENSMUST00000114516
SMART Domains Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061

DomainStartEndE-ValueType
low complexity region 451 472 N/A INTRINSIC
coiled coil region 548 568 N/A INTRINSIC
coiled coil region 599 650 N/A INTRINSIC
low complexity region 743 754 N/A INTRINSIC
low complexity region 883 891 N/A INTRINSIC
RING 938 977 2.09e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121869
AA Change: H439L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061
AA Change: H439L

DomainStartEndE-ValueType
low complexity region 657 678 N/A INTRINSIC
coiled coil region 754 774 N/A INTRINSIC
coiled coil region 805 856 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 1089 1097 N/A INTRINSIC
RING 1144 1183 2.09e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (66/68)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik A G 14: 41,983,221 probably null Het
2310034C09Rik A G 16: 88,759,354 Y152C probably benign Het
4921530L21Rik A T 14: 95,882,591 K261N probably benign Het
5830411N06Rik A T 7: 140,261,607 T275S probably benign Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Akap1 A G 11: 88,845,528 S103P probably damaging Het
Ampd1 T A 3: 103,074,119 probably null Het
Apoa1 T A 9: 46,229,802 probably null Het
Asb16 A G 11: 102,272,655 D157G possibly damaging Het
Bank1 T C 3: 136,055,800 N748D possibly damaging Het
BC034090 C A 1: 155,226,381 G46W probably damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Ccdc73 T A 2: 104,951,869 V190E probably damaging Het
Cyb561a3 A G 19: 10,582,332 Y7C probably damaging Het
Cyp2t4 A T 7: 27,158,243 D427V probably damaging Het
Cyp4f14 T C 17: 32,909,157 T295A probably benign Het
D430041D05Rik T C 2: 104,257,102 T510A probably benign Het
Dennd6a G T 14: 26,579,710 E26* probably null Het
Dusp10 T C 1: 184,069,221 I395T probably damaging Het
Heatr5b T A 17: 78,768,533 D1452V probably benign Het
Hsd3b2 A G 3: 98,711,796 F278L probably benign Het
Hspg2 T A 4: 137,515,664 M702K probably damaging Het
Hydin T C 8: 110,583,914 F4081L probably damaging Het
Ido1 T G 8: 24,586,916 T209P probably benign Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ipo8 T C 6: 148,789,805 Y689C probably benign Het
Macf1 C T 4: 123,456,643 R3809Q probably benign Het
Manea T C 4: 26,328,228 Y271C probably damaging Het
Mroh2b A G 15: 4,941,554 T1014A probably benign Het
Nek5 A G 8: 22,108,040 F200L probably damaging Het
Nipal1 A G 5: 72,667,641 I226V probably benign Het
Nipsnap3a A T 4: 52,994,159 N80I probably damaging Het
Nmur1 G A 1: 86,386,378 P389S probably benign Het
Olfr1037 T C 2: 86,084,907 Y290C probably damaging Het
Olfr59 T C 11: 74,288,685 L13P possibly damaging Het
Olfr975 G T 9: 39,950,053 C239* probably null Het
Patl2 A C 2: 122,127,525 V84G probably benign Het
Pcdhb4 T C 18: 37,309,275 V546A probably damaging Het
Phf20l1 G T 15: 66,597,750 S168I possibly damaging Het
Phgdh T C 3: 98,339,729 N35S probably benign Het
Pigw A T 11: 84,877,963 M180K probably damaging Het
Pkhd1 G T 1: 20,200,701 H3209Q probably benign Het
Plbd2 A G 5: 120,486,796 F436L probably damaging Het
Plch2 T C 4: 154,984,096 T1358A probably benign Het
Poll C T 19: 45,553,057 V491M probably damaging Het
Polr1e A G 4: 45,024,553 probably null Het
Ppp1r35 G A 5: 137,780,017 W258* probably null Het
Ptpdc1 A T 13: 48,586,666 F430I probably benign Het
Ptprh T C 7: 4,552,743 E739G probably damaging Het
Ramp2 T C 11: 101,247,939 V148A possibly damaging Het
Rapgef6 T C 11: 54,610,921 probably null Het
Rbm5 A G 9: 107,750,394 probably null Het
Rnf39 A T 17: 36,943,349 S88C probably benign Het
Rpl12 A G 2: 32,963,824 I155V probably benign Het
Senp5 C T 16: 31,976,029 E596K unknown Het
Serpinb9d A G 13: 33,195,933 Y85C probably benign Het
Serpinf1 T A 11: 75,416,316 Y65F probably benign Het
Snrnp200 G A 2: 127,226,484 probably null Het
Spatc1 A T 15: 76,268,368 Q66L probably benign Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,368,229 probably benign Het
Traf3ip1 A G 1: 91,511,388 D342G probably benign Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ube2j2 T C 4: 155,957,331 V249A probably damaging Het
Utrn A C 10: 12,439,791 N3025K possibly damaging Het
Vmn1r17 T A 6: 57,360,877 M168L probably benign Het
Vmn1r77 T A 7: 12,041,767 S157T probably benign Het
Zfp977 A G 7: 42,580,460 S214P probably benign Het
Zscan10 T C 17: 23,610,005 L507P possibly damaging Het
Other mutations in Dzip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Dzip3 APN 16 48928415 missense probably damaging 1.00
IGL00931:Dzip3 APN 16 48935497 critical splice donor site probably null
IGL01109:Dzip3 APN 16 48929674 missense probably benign 0.27
IGL01121:Dzip3 APN 16 48944881 missense probably benign 0.10
IGL01328:Dzip3 APN 16 48972258 missense probably damaging 1.00
IGL01729:Dzip3 APN 16 48928363 missense possibly damaging 0.78
IGL02044:Dzip3 APN 16 48948427 missense possibly damaging 0.90
IGL02051:Dzip3 APN 16 48972254 missense probably benign 0.01
IGL02115:Dzip3 APN 16 48948485 missense probably benign 0.00
IGL02125:Dzip3 APN 16 48927596 missense probably damaging 1.00
IGL02136:Dzip3 APN 16 48927582 missense possibly damaging 0.94
IGL02244:Dzip3 APN 16 48980988 missense probably benign 0.01
IGL02253:Dzip3 APN 16 48944924 missense probably benign 0.34
IGL02412:Dzip3 APN 16 48958457 missense probably benign 0.00
IGL02452:Dzip3 APN 16 48938537 splice site probably benign
IGL02481:Dzip3 APN 16 48975551 splice site probably benign
IGL02499:Dzip3 APN 16 48933850 missense probably damaging 1.00
IGL02511:Dzip3 APN 16 48936980 missense possibly damaging 0.75
IGL02519:Dzip3 APN 16 48928396 missense probably damaging 1.00
IGL02610:Dzip3 APN 16 48951653 missense probably damaging 1.00
IGL03129:Dzip3 APN 16 48942083 missense possibly damaging 0.51
IGL03342:Dzip3 APN 16 48929623 missense probably damaging 0.98
IGL03493:Dzip3 APN 16 48951696 missense probably benign 0.32
dazwick UTSW 16 48958465 missense possibly damaging 0.90
1mM(1):Dzip3 UTSW 16 48951557 missense probably damaging 1.00
PIT4651001:Dzip3 UTSW 16 48944878 missense probably benign
R0313:Dzip3 UTSW 16 48937061 missense probably damaging 0.99
R0483:Dzip3 UTSW 16 48947713 missense possibly damaging 0.94
R0504:Dzip3 UTSW 16 48959643 splice site probably benign
R0744:Dzip3 UTSW 16 48959675 missense probably damaging 1.00
R0800:Dzip3 UTSW 16 48953808 splice site probably benign
R0927:Dzip3 UTSW 16 48975477 missense probably damaging 0.99
R0931:Dzip3 UTSW 16 48951558 missense probably damaging 1.00
R1170:Dzip3 UTSW 16 48961208 missense probably damaging 1.00
R1203:Dzip3 UTSW 16 48951817 missense probably damaging 1.00
R1205:Dzip3 UTSW 16 48951681 missense probably damaging 1.00
R1442:Dzip3 UTSW 16 48945622 missense probably benign 0.19
R1526:Dzip3 UTSW 16 48937006 missense probably damaging 1.00
R1560:Dzip3 UTSW 16 48951540 splice site probably null
R1585:Dzip3 UTSW 16 48977878 splice site probably benign
R1682:Dzip3 UTSW 16 48958417 critical splice donor site probably null
R1957:Dzip3 UTSW 16 48927593 missense probably damaging 1.00
R2472:Dzip3 UTSW 16 48953787 missense possibly damaging 0.85
R2571:Dzip3 UTSW 16 48972218 splice site probably null
R3040:Dzip3 UTSW 16 48928324 missense probably damaging 1.00
R3081:Dzip3 UTSW 16 48927558 missense probably damaging 1.00
R3615:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3616:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3786:Dzip3 UTSW 16 48975543 missense probably benign 0.08
R3851:Dzip3 UTSW 16 48950013 missense possibly damaging 0.94
R4097:Dzip3 UTSW 16 48958489 nonsense probably null
R4371:Dzip3 UTSW 16 48943455 critical splice donor site probably null
R4612:Dzip3 UTSW 16 48952040 nonsense probably null
R4671:Dzip3 UTSW 16 48979590 nonsense probably null
R4695:Dzip3 UTSW 16 48951561 missense probably damaging 1.00
R4696:Dzip3 UTSW 16 48925969 unclassified probably benign
R4769:Dzip3 UTSW 16 48938474 missense probably damaging 0.97
R5063:Dzip3 UTSW 16 48953754 nonsense probably null
R5321:Dzip3 UTSW 16 48957675 missense possibly damaging 0.95
R5764:Dzip3 UTSW 16 48927361 intron probably benign
R6020:Dzip3 UTSW 16 48951842 missense probably damaging 1.00
R6218:Dzip3 UTSW 16 48958465 missense possibly damaging 0.90
R6300:Dzip3 UTSW 16 48951807 missense probably damaging 1.00
R6365:Dzip3 UTSW 16 48931273 missense probably damaging 0.96
R6778:Dzip3 UTSW 16 48982083 missense probably benign 0.00
R6915:Dzip3 UTSW 16 48942125 missense possibly damaging 0.72
R7047:Dzip3 UTSW 16 48982126 missense probably benign 0.04
R7059:Dzip3 UTSW 16 48980942 missense probably benign 0.34
R7095:Dzip3 UTSW 16 48927790 missense probably benign
R7227:Dzip3 UTSW 16 48951569 missense probably damaging 0.99
R7319:Dzip3 UTSW 16 48927540 critical splice donor site probably null
R7469:Dzip3 UTSW 16 48944879 missense probably benign
R7526:Dzip3 UTSW 16 48975474 missense probably damaging 0.99
R7964:Dzip3 UTSW 16 48951905 missense probably damaging 1.00
R8131:Dzip3 UTSW 16 48933793 critical splice donor site probably null
R8188:Dzip3 UTSW 16 48952136 missense probably damaging 1.00
R8209:Dzip3 UTSW 16 48977944 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCAGAAGATGGTGGTTCC -3'
(R):5'- CCTTAGGGTGCAATGTGAGAG -3'

Sequencing Primer
(F):5'- GGTGGTTCCATATCCCAGC -3'
(R):5'- CCTTAGGGTGCAATGTGAGAGACTAC -3'
Posted On2019-10-07