Incidental Mutation 'R7436:Rnf39'
ID580583
Institutional Source Beutler Lab
Gene Symbol Rnf39
Ensembl Gene ENSMUSG00000036492
Gene Namering finger protein 39
SynonymsLOC240094, LIRF, LOC386454, LOC386465
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7436 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location36942918-36947986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36943349 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 88 (S88C)
Ref Sequence ENSEMBL: ENSMUSP00000037860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040498] [ENSMUST00000173072] [ENSMUST00000174669]
Predicted Effect probably benign
Transcript: ENSMUST00000040498
AA Change: S88C

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037860
Gene: ENSMUSG00000036492
AA Change: S88C

DomainStartEndE-ValueType
RING 20 66 3.47e-4 SMART
low complexity region 99 109 N/A INTRINSIC
PRY 159 212 6.23e-15 SMART
Blast:SPRY 213 349 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173072
AA Change: S88C

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133710
Gene: ENSMUSG00000036492
AA Change: S88C

DomainStartEndE-ValueType
RING 20 66 3.47e-4 SMART
low complexity region 99 109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174669
SMART Domains Protein: ENSMUSP00000134113
Gene: ENSMUSG00000036492

DomainStartEndE-ValueType
PRY 37 90 6.23e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene lies within the major histocompatibility complex class I region on chromosome 6. Studies of a similar rat protein suggest that this gene encodes a protein that plays a role in an early phase of synaptic plasticity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik A G 14: 41,983,221 probably null Het
2310034C09Rik A G 16: 88,759,354 Y152C probably benign Het
4921530L21Rik A T 14: 95,882,591 K261N probably benign Het
5830411N06Rik A T 7: 140,261,607 T275S probably benign Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Akap1 A G 11: 88,845,528 S103P probably damaging Het
Ampd1 T A 3: 103,074,119 probably null Het
Apoa1 T A 9: 46,229,802 probably null Het
Asb16 A G 11: 102,272,655 D157G possibly damaging Het
Bank1 T C 3: 136,055,800 N748D possibly damaging Het
BC034090 C A 1: 155,226,381 G46W probably damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Ccdc73 T A 2: 104,951,869 V190E probably damaging Het
Cyb561a3 A G 19: 10,582,332 Y7C probably damaging Het
Cyp2t4 A T 7: 27,158,243 D427V probably damaging Het
Cyp4f14 T C 17: 32,909,157 T295A probably benign Het
D430041D05Rik T C 2: 104,257,102 T510A probably benign Het
Dennd6a G T 14: 26,579,710 E26* probably null Het
Dusp10 T C 1: 184,069,221 I395T probably damaging Het
Dzip3 T A 16: 48,951,989 H439L probably damaging Het
Heatr5b T A 17: 78,768,533 D1452V probably benign Het
Hsd3b2 A G 3: 98,711,796 F278L probably benign Het
Hspg2 T A 4: 137,515,664 M702K probably damaging Het
Hydin T C 8: 110,583,914 F4081L probably damaging Het
Ido1 T G 8: 24,586,916 T209P probably benign Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ipo8 T C 6: 148,789,805 Y689C probably benign Het
Macf1 C T 4: 123,456,643 R3809Q probably benign Het
Manea T C 4: 26,328,228 Y271C probably damaging Het
Mroh2b A G 15: 4,941,554 T1014A probably benign Het
Nek5 A G 8: 22,108,040 F200L probably damaging Het
Nipal1 A G 5: 72,667,641 I226V probably benign Het
Nipsnap3a A T 4: 52,994,159 N80I probably damaging Het
Nmur1 G A 1: 86,386,378 P389S probably benign Het
Olfr1037 T C 2: 86,084,907 Y290C probably damaging Het
Olfr59 T C 11: 74,288,685 L13P possibly damaging Het
Olfr975 G T 9: 39,950,053 C239* probably null Het
Patl2 A C 2: 122,127,525 V84G probably benign Het
Pcdhb4 T C 18: 37,309,275 V546A probably damaging Het
Phf20l1 G T 15: 66,597,750 S168I possibly damaging Het
Phgdh T C 3: 98,339,729 N35S probably benign Het
Pigw A T 11: 84,877,963 M180K probably damaging Het
Pkhd1 G T 1: 20,200,701 H3209Q probably benign Het
Plbd2 A G 5: 120,486,796 F436L probably damaging Het
Plch2 T C 4: 154,984,096 T1358A probably benign Het
Poll C T 19: 45,553,057 V491M probably damaging Het
Polr1e A G 4: 45,024,553 probably null Het
Ppp1r35 G A 5: 137,780,017 W258* probably null Het
Ptpdc1 A T 13: 48,586,666 F430I probably benign Het
Ptprh T C 7: 4,552,743 E739G probably damaging Het
Ramp2 T C 11: 101,247,939 V148A possibly damaging Het
Rapgef6 T C 11: 54,610,921 probably null Het
Rbm5 A G 9: 107,750,394 probably null Het
Rpl12 A G 2: 32,963,824 I155V probably benign Het
Senp5 C T 16: 31,976,029 E596K unknown Het
Serpinb9d A G 13: 33,195,933 Y85C probably benign Het
Serpinf1 T A 11: 75,416,316 Y65F probably benign Het
Snrnp200 G A 2: 127,226,484 probably null Het
Spatc1 A T 15: 76,268,368 Q66L probably benign Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,368,229 probably benign Het
Traf3ip1 A G 1: 91,511,388 D342G probably benign Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ube2j2 T C 4: 155,957,331 V249A probably damaging Het
Utrn A C 10: 12,439,791 N3025K possibly damaging Het
Vmn1r17 T A 6: 57,360,877 M168L probably benign Het
Vmn1r77 T A 7: 12,041,767 S157T probably benign Het
Zfp977 A G 7: 42,580,460 S214P probably benign Het
Zscan10 T C 17: 23,610,005 L507P possibly damaging Het
Other mutations in Rnf39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Rnf39 APN 17 36945436 missense possibly damaging 0.84
IGL02852:Rnf39 APN 17 36945202 unclassified probably benign
R3771:Rnf39 UTSW 17 36947229 missense probably damaging 1.00
R3967:Rnf39 UTSW 17 36943143 missense probably damaging 1.00
R5026:Rnf39 UTSW 17 36945534 missense probably benign 0.18
R5294:Rnf39 UTSW 17 36947200 missense probably damaging 1.00
R6139:Rnf39 UTSW 17 36943338 missense probably damaging 1.00
R6699:Rnf39 UTSW 17 36947229 missense probably damaging 1.00
R7396:Rnf39 UTSW 17 36947079 missense probably damaging 0.98
R7536:Rnf39 UTSW 17 36943117 missense probably damaging 1.00
R7888:Rnf39 UTSW 17 36947241 missense probably damaging 0.99
R8164:Rnf39 UTSW 17 36943400 missense probably damaging 0.98
X0067:Rnf39 UTSW 17 36943266 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTCTGAGTCCGATCTGGGTAAC -3'
(R):5'- AAAAGCATGGCTCCCACCTTTG -3'

Sequencing Primer
(F):5'- GACCCCTGCTTTCCATGGAG -3'
(R):5'- TTTGCTAGGACACCCACAAAC -3'
Posted On2019-10-07