Incidental Mutation 'R7436:Heatr5b'
ID580584
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene NameHEAT repeat containing 5B
Synonyms2010013B10Rik, A230048G03Rik, D330050P16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R7436 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location78752906-78835381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78768533 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1452 (D1452V)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
Predicted Effect probably benign
Transcript: ENSMUST00000097281
AA Change: D1452V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: D1452V

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A G 16: 88,759,354 Y152C probably benign Het
4921530L21Rik A T 14: 95,882,591 K261N probably benign Het
5830411N06Rik A T 7: 140,261,607 T275S probably benign Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Akap1 A G 11: 88,845,528 S103P probably damaging Het
Ampd1 T A 3: 103,074,119 probably null Het
Asb16 A G 11: 102,272,655 D157G possibly damaging Het
Bank1 T C 3: 136,055,800 N748D possibly damaging Het
BC034090 C A 1: 155,226,381 G46W probably damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Ccdc73 T A 2: 104,951,869 V190E probably damaging Het
Cyb561a3 A G 19: 10,582,332 Y7C probably damaging Het
Cyp2t4 A T 7: 27,158,243 D427V probably damaging Het
Cyp4f14 T C 17: 32,909,157 T295A probably benign Het
D430041D05Rik T C 2: 104,257,102 T510A probably benign Het
Dennd6a G T 14: 26,579,710 E26* probably null Het
Dusp10 T C 1: 184,069,221 I395T probably damaging Het
Dzip3 T A 16: 48,951,989 H439L probably damaging Het
Hsd3b2 A G 3: 98,711,796 F278L probably benign Het
Hspg2 T A 4: 137,515,664 M702K probably damaging Het
Hydin T C 8: 110,583,914 F4081L probably damaging Het
Ido1 T G 8: 24,586,916 T209P probably benign Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ipo8 T C 6: 148,789,805 Y689C probably benign Het
Macf1 C T 4: 123,456,643 R3809Q probably benign Het
Manea T C 4: 26,328,228 Y271C probably damaging Het
Mroh2b A G 15: 4,941,554 T1014A probably benign Het
Nek5 A G 8: 22,108,040 F200L probably damaging Het
Nipal1 A G 5: 72,667,641 I226V probably benign Het
Nipsnap3a A T 4: 52,994,159 N80I probably damaging Het
Nmur1 G A 1: 86,386,378 P389S probably benign Het
Olfr1037 T C 2: 86,084,907 Y290C probably damaging Het
Olfr59 T C 11: 74,288,685 L13P possibly damaging Het
Olfr975 G T 9: 39,950,053 C239* probably null Het
Patl2 A C 2: 122,127,525 V84G probably benign Het
Pcdhb4 T C 18: 37,309,275 V546A probably damaging Het
Phf20l1 G T 15: 66,597,750 S168I possibly damaging Het
Phgdh T C 3: 98,339,729 N35S probably benign Het
Pigw A T 11: 84,877,963 M180K probably damaging Het
Pkhd1 G T 1: 20,200,701 H3209Q probably benign Het
Plbd2 A G 5: 120,486,796 F436L probably damaging Het
Plch2 T C 4: 154,984,096 T1358A probably benign Het
Poll C T 19: 45,553,057 V491M probably damaging Het
Ppp1r35 G A 5: 137,780,017 W258* probably null Het
Ptpdc1 A T 13: 48,586,666 F430I probably benign Het
Ptprh T C 7: 4,552,743 E739G probably damaging Het
Ramp2 T C 11: 101,247,939 V148A possibly damaging Het
Rapgef6 T C 11: 54,610,921 probably null Het
Rnf39 A T 17: 36,943,349 S88C probably benign Het
Rpl12 A G 2: 32,963,824 I155V probably benign Het
Senp5 C T 16: 31,976,029 E596K unknown Het
Serpinb9d A G 13: 33,195,933 Y85C probably benign Het
Serpinf1 T A 11: 75,416,316 Y65F probably benign Het
Snrnp200 G A 2: 127,226,484 probably null Het
Spatc1 A T 15: 76,268,368 Q66L probably benign Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,368,229 probably benign Het
Traf3ip1 A G 1: 91,511,388 D342G probably benign Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ube2j2 T C 4: 155,957,331 V249A probably damaging Het
Utrn A C 10: 12,439,791 N3025K possibly damaging Het
Vmn1r17 T A 6: 57,360,877 M168L probably benign Het
Vmn1r77 T A 7: 12,041,767 S157T probably benign Het
Zfp977 A G 7: 42,580,460 S214P probably benign Het
Zscan10 T C 17: 23,610,005 L507P possibly damaging Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7519:Heatr5b UTSW 17 78755217 missense probably benign
R7606:Heatr5b UTSW 17 78763026 missense probably benign
R7673:Heatr5b UTSW 17 78795983 missense probably damaging 0.97
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CACGTAGTACTTACCATCTGGGG -3'
(R):5'- AGCAGAAGGTAATGTCACTCTTTAG -3'

Sequencing Primer
(F):5'- TTACCATCTGGGGGAAGCTGAC -3'
(R):5'- CGGATCTCTGTTAATTCAAGGCCAG -3'
Posted On2019-10-07