Incidental Mutation 'R7436:Heatr5b'
ID580584
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene NameHEAT repeat containing 5B
Synonyms2010013B10Rik, A230048G03Rik, D330050P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.525) question?
Stock #R7436 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location78752906-78835381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78768533 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1452 (D1452V)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
Predicted Effect probably benign
Transcript: ENSMUST00000097281
AA Change: D1452V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: D1452V

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Meta Mutation Damage Score 0.0874 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik A G 14: 41,983,221 probably null Het
2310034C09Rik A G 16: 88,759,354 Y152C probably benign Het
4921530L21Rik A T 14: 95,882,591 K261N probably benign Het
5830411N06Rik A T 7: 140,261,607 T275S probably benign Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Akap1 A G 11: 88,845,528 S103P probably damaging Het
Ampd1 T A 3: 103,074,119 probably null Het
Apoa1 T A 9: 46,229,802 probably null Het
Asb16 A G 11: 102,272,655 D157G possibly damaging Het
Bank1 T C 3: 136,055,800 N748D possibly damaging Het
BC034090 C A 1: 155,226,381 G46W probably damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Ccdc73 T A 2: 104,951,869 V190E probably damaging Het
Cyb561a3 A G 19: 10,582,332 Y7C probably damaging Het
Cyp2t4 A T 7: 27,158,243 D427V probably damaging Het
Cyp4f14 T C 17: 32,909,157 T295A probably benign Het
D430041D05Rik T C 2: 104,257,102 T510A probably benign Het
Dennd6a G T 14: 26,579,710 E26* probably null Het
Dusp10 T C 1: 184,069,221 I395T probably damaging Het
Dzip3 T A 16: 48,951,989 H439L probably damaging Het
Hsd3b2 A G 3: 98,711,796 F278L probably benign Het
Hspg2 T A 4: 137,515,664 M702K probably damaging Het
Hydin T C 8: 110,583,914 F4081L probably damaging Het
Ido1 T G 8: 24,586,916 T209P probably benign Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ipo8 T C 6: 148,789,805 Y689C probably benign Het
Macf1 C T 4: 123,456,643 R3809Q probably benign Het
Manea T C 4: 26,328,228 Y271C probably damaging Het
Mroh2b A G 15: 4,941,554 T1014A probably benign Het
Nek5 A G 8: 22,108,040 F200L probably damaging Het
Nipal1 A G 5: 72,667,641 I226V probably benign Het
Nipsnap3a A T 4: 52,994,159 N80I probably damaging Het
Nmur1 G A 1: 86,386,378 P389S probably benign Het
Olfr1037 T C 2: 86,084,907 Y290C probably damaging Het
Olfr59 T C 11: 74,288,685 L13P possibly damaging Het
Olfr975 G T 9: 39,950,053 C239* probably null Het
Patl2 A C 2: 122,127,525 V84G probably benign Het
Pcdhb4 T C 18: 37,309,275 V546A probably damaging Het
Phf20l1 G T 15: 66,597,750 S168I possibly damaging Het
Phgdh T C 3: 98,339,729 N35S probably benign Het
Pigw A T 11: 84,877,963 M180K probably damaging Het
Pkhd1 G T 1: 20,200,701 H3209Q probably benign Het
Plbd2 A G 5: 120,486,796 F436L probably damaging Het
Plch2 T C 4: 154,984,096 T1358A probably benign Het
Poll C T 19: 45,553,057 V491M probably damaging Het
Polr1e A G 4: 45,024,553 probably null Het
Ppp1r35 G A 5: 137,780,017 W258* probably null Het
Ptpdc1 A T 13: 48,586,666 F430I probably benign Het
Ptprh T C 7: 4,552,743 E739G probably damaging Het
Ramp2 T C 11: 101,247,939 V148A possibly damaging Het
Rapgef6 T C 11: 54,610,921 probably null Het
Rbm5 A G 9: 107,750,394 probably null Het
Rnf39 A T 17: 36,943,349 S88C probably benign Het
Rpl12 A G 2: 32,963,824 I155V probably benign Het
Senp5 C T 16: 31,976,029 E596K unknown Het
Serpinb9d A G 13: 33,195,933 Y85C probably benign Het
Serpinf1 T A 11: 75,416,316 Y65F probably benign Het
Snrnp200 G A 2: 127,226,484 probably null Het
Spatc1 A T 15: 76,268,368 Q66L probably benign Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,368,229 probably benign Het
Traf3ip1 A G 1: 91,511,388 D342G probably benign Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ube2j2 T C 4: 155,957,331 V249A probably damaging Het
Utrn A C 10: 12,439,791 N3025K possibly damaging Het
Vmn1r17 T A 6: 57,360,877 M168L probably benign Het
Vmn1r77 T A 7: 12,041,767 S157T probably benign Het
Zfp977 A G 7: 42,580,460 S214P probably benign Het
Zscan10 T C 17: 23,610,005 L507P possibly damaging Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7519:Heatr5b UTSW 17 78755217 missense probably benign
R7606:Heatr5b UTSW 17 78763026 missense probably benign
R7673:Heatr5b UTSW 17 78795983 missense probably damaging 0.97
R7782:Heatr5b UTSW 17 78795941 missense probably damaging 0.99
R7790:Heatr5b UTSW 17 78818823 missense probably damaging 0.99
R7922:Heatr5b UTSW 17 78760559 missense probably benign 0.01
R8184:Heatr5b UTSW 17 78814233 missense probably benign 0.03
R8222:Heatr5b UTSW 17 78801701 missense possibly damaging 0.95
R8276:Heatr5b UTSW 17 78791539 nonsense probably null
R8324:Heatr5b UTSW 17 78755364 missense possibly damaging 0.85
R8430:Heatr5b UTSW 17 78829624 missense probably damaging 0.97
R8432:Heatr5b UTSW 17 78803501 missense probably damaging 0.99
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CACGTAGTACTTACCATCTGGGG -3'
(R):5'- AGCAGAAGGTAATGTCACTCTTTAG -3'

Sequencing Primer
(F):5'- TTACCATCTGGGGGAAGCTGAC -3'
(R):5'- CGGATCTCTGTTAATTCAAGGCCAG -3'
Posted On2019-10-07