Incidental Mutation 'R7283:Invs'
ID 580607
Institutional Source Beutler Lab
Gene Symbol Invs
Ensembl Gene ENSMUSG00000028344
Gene Name inversin
Synonyms
MMRRC Submission 045361-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.658) question?
Stock # R7283 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 48279760-48431954 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 48392526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030029] [ENSMUST00000143433]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000030029
SMART Domains Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 148 177 6.46e-4 SMART
ANK 181 215 3.44e1 SMART
ANK 220 250 1.11e-2 SMART
ANK 254 285 2.07e-2 SMART
ANK 288 317 3.18e-3 SMART
ANK 321 350 3.91e-3 SMART
ANK 356 385 2.28e-4 SMART
ANK 389 418 8.39e-3 SMART
ANK 422 451 3.76e-5 SMART
ANK 455 484 2.45e-4 SMART
ANK 488 517 1.31e-4 SMART
ANK 523 553 6.71e-2 SMART
IQ 554 576 5.75e-2 SMART
low complexity region 589 607 N/A INTRINSIC
IQ 913 935 2.46e-1 SMART
low complexity region 973 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143433
SMART Domains Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 164 194 1.11e-2 SMART
ANK 198 229 2.07e-2 SMART
ANK 232 261 3.18e-3 SMART
ANK 265 294 3.91e-3 SMART
ANK 300 329 2.28e-4 SMART
ANK 333 362 8.39e-3 SMART
ANK 366 395 3.76e-5 SMART
ANK 399 428 2.45e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Transgenic mice homozygous for an insertional mutation exhibit complete inversion of the L-R body axis, reversal of embryo turning, complex cardiac anomalies, an abnormally slow turbulent leftward nodal flow, and renal cyst formation. Most succumb to renal failure within 1 week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,700,504 (GRCm39) V278A probably benign Het
Abcc3 C T 11: 94,247,873 (GRCm39) A1207T probably benign Het
Abce1 C A 8: 80,411,885 (GRCm39) G592* probably null Het
Acad10 A C 5: 121,787,538 (GRCm39) V137G possibly damaging Het
Adcy3 A G 12: 4,253,563 (GRCm39) I672V not run Het
Adgrb1 A T 15: 74,452,512 (GRCm39) Q1166L possibly damaging Het
Ankrd44 A T 1: 54,768,955 (GRCm39) N465K probably damaging Het
Avpr1b A G 1: 131,537,469 (GRCm39) T418A probably benign Het
Azin1 G A 15: 38,501,652 (GRCm39) T33I probably damaging Het
Bicra T C 7: 15,706,425 (GRCm39) T1339A probably damaging Het
Bltp2 A G 11: 78,165,654 (GRCm39) Q1346R probably damaging Het
Cacna1s A G 1: 136,001,446 (GRCm39) Y299C probably damaging Het
Clip1 A C 5: 123,751,857 (GRCm39) C641W Het
Clip3 T C 7: 30,005,237 (GRCm39) S524P probably damaging Het
Cnpy4 A T 5: 138,191,144 (GRCm39) H240L probably benign Het
Cyp2b19 T C 7: 26,466,339 (GRCm39) Y381H probably damaging Het
Cyp3a13 T A 5: 137,903,818 (GRCm39) N280I probably benign Het
Diaph3 A G 14: 87,104,020 (GRCm39) F788S probably damaging Het
Drc7 A G 8: 95,798,207 (GRCm39) N484S probably damaging Het
Erap1 G A 13: 74,821,903 (GRCm39) probably null Het
Fat4 A T 3: 38,943,842 (GRCm39) I912F probably damaging Het
Hsd3b3 T A 3: 98,649,673 (GRCm39) K217* probably null Het
Igkv12-89 A G 6: 68,812,061 (GRCm39) V36A probably damaging Het
Ipo8 T A 6: 148,725,979 (GRCm39) Y30F possibly damaging Het
Kctd14 T C 7: 97,100,693 (GRCm39) M1T probably null Het
Klrb1c A T 6: 128,761,220 (GRCm39) C136S probably benign Het
Morn2 A G 17: 80,604,688 (GRCm39) E48G probably damaging Het
Myh1 A T 11: 67,092,670 (GRCm39) probably null Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nfxl1 A G 5: 72,686,393 (GRCm39) S603P probably benign Het
Nlrc3 G A 16: 3,765,741 (GRCm39) A351V probably benign Het
Nlrp4f G A 13: 65,343,352 (GRCm39) R76* probably null Het
Or1e1f T C 11: 73,855,634 (GRCm39) S67P probably damaging Het
Or52n1 G T 7: 104,382,800 (GRCm39) T257K probably damaging Het
Or5h22 A T 16: 58,894,555 (GRCm39) M296K probably benign Het
Or7e176 A C 9: 20,171,555 (GRCm39) I140L probably damaging Het
Or8k41 A T 2: 86,313,483 (GRCm39) I201N probably damaging Het
Papolg A G 11: 23,817,394 (GRCm39) V601A not run Het
Pde4dip T C 3: 97,666,198 (GRCm39) T349A probably benign Het
Pdlim5 T C 3: 142,017,741 (GRCm39) probably null Het
Pkhd1l1 A G 15: 44,366,676 (GRCm39) N718S probably benign Het
Plcxd3 A G 15: 4,546,401 (GRCm39) H135R probably damaging Het
Plxna2 A T 1: 194,327,191 (GRCm39) Y375F probably damaging Het
Prkca C T 11: 108,231,471 (GRCm39) probably null Het
Prkdc A G 16: 15,535,628 (GRCm39) S1663G probably benign Het
Ptbp3 T C 4: 59,514,384 (GRCm39) T80A probably benign Het
Ptpn4 C T 1: 119,610,261 (GRCm39) V696I possibly damaging Het
Pygl A T 12: 70,263,342 (GRCm39) W175R possibly damaging Het
Rftn1 A G 17: 50,354,469 (GRCm39) Y298H probably damaging Het
Rit2 A G 18: 31,449,892 (GRCm39) probably null Het
Runx1t1 G A 4: 13,846,935 (GRCm39) G240R probably damaging Het
Scn10a A G 9: 119,493,845 (GRCm39) probably null Het
Serpina16 A C 12: 103,638,691 (GRCm39) probably null Het
Slc17a3 A T 13: 24,039,831 (GRCm39) M290L Het
Slc6a4 A T 11: 76,901,522 (GRCm39) M86L probably benign Het
Spag7 A T 11: 70,556,139 (GRCm39) V46E probably benign Het
Spata31h1 G A 10: 82,127,131 (GRCm39) R1960W possibly damaging Het
Sptlc1 T C 13: 53,498,914 (GRCm39) I271V probably benign Het
Stk17b A C 1: 53,796,674 (GRCm39) H364Q probably benign Het
Strc T C 2: 121,209,933 (GRCm39) H130R probably damaging Het
Stxbp1 T A 2: 32,705,026 (GRCm39) D148V probably damaging Het
Tirap G A 9: 35,100,225 (GRCm39) P153L probably damaging Het
Tmco3 G A 8: 13,369,605 (GRCm39) probably null Het
Tmem51 T A 4: 141,759,094 (GRCm39) D218V probably damaging Het
Trim40 A T 17: 37,193,554 (GRCm39) D218E probably benign Het
Ttc21b T C 2: 66,039,062 (GRCm39) D934G probably damaging Het
Vmn2r26 T C 6: 124,002,914 (GRCm39) L108P probably damaging Het
Washc2 C A 6: 116,204,379 (GRCm39) P429Q probably damaging Het
Wipi1 A G 11: 109,502,137 (GRCm39) M1T probably null Het
Zfp438 A G 18: 5,214,712 (GRCm39) V82A probably damaging Het
Zfp853 G C 5: 143,273,493 (GRCm39) A724G unknown Het
Other mutations in Invs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Invs APN 4 48,402,909 (GRCm39) missense probably damaging 0.98
IGL00487:Invs APN 4 48,407,689 (GRCm39) nonsense probably null
IGL01487:Invs APN 4 48,398,136 (GRCm39) missense probably benign 0.26
IGL01696:Invs APN 4 48,425,997 (GRCm39) missense probably damaging 1.00
IGL02238:Invs APN 4 48,390,029 (GRCm39) missense probably damaging 1.00
IGL03286:Invs APN 4 48,382,261 (GRCm39) missense probably benign 0.26
R0645:Invs UTSW 4 48,407,653 (GRCm39) missense probably benign 0.00
R0661:Invs UTSW 4 48,421,861 (GRCm39) missense probably benign
R0698:Invs UTSW 4 48,396,364 (GRCm39) missense probably benign 0.04
R0763:Invs UTSW 4 48,392,628 (GRCm39) missense possibly damaging 0.82
R1183:Invs UTSW 4 48,421,725 (GRCm39) missense possibly damaging 0.68
R1381:Invs UTSW 4 48,421,942 (GRCm39) nonsense probably null
R1511:Invs UTSW 4 48,382,148 (GRCm39) missense possibly damaging 0.82
R1843:Invs UTSW 4 48,422,035 (GRCm39) missense probably damaging 0.96
R1903:Invs UTSW 4 48,402,824 (GRCm39) splice site probably null
R1928:Invs UTSW 4 48,390,095 (GRCm39) missense probably damaging 1.00
R1990:Invs UTSW 4 48,392,599 (GRCm39) missense possibly damaging 0.88
R2063:Invs UTSW 4 48,396,287 (GRCm39) missense probably damaging 1.00
R2064:Invs UTSW 4 48,396,287 (GRCm39) missense probably damaging 1.00
R2065:Invs UTSW 4 48,396,287 (GRCm39) missense probably damaging 1.00
R2066:Invs UTSW 4 48,396,287 (GRCm39) missense probably damaging 1.00
R4744:Invs UTSW 4 48,397,609 (GRCm39) missense probably damaging 1.00
R4997:Invs UTSW 4 48,396,332 (GRCm39) missense probably damaging 0.98
R5011:Invs UTSW 4 48,421,807 (GRCm39) missense probably damaging 1.00
R5013:Invs UTSW 4 48,421,807 (GRCm39) missense probably damaging 1.00
R5083:Invs UTSW 4 48,396,307 (GRCm39) missense possibly damaging 0.90
R5184:Invs UTSW 4 48,283,242 (GRCm39) utr 5 prime probably benign
R5258:Invs UTSW 4 48,396,374 (GRCm39) missense possibly damaging 0.82
R5375:Invs UTSW 4 48,385,262 (GRCm39) missense probably benign 0.12
R5509:Invs UTSW 4 48,396,337 (GRCm39) missense probably damaging 1.00
R5560:Invs UTSW 4 48,416,084 (GRCm39) missense probably benign 0.00
R5748:Invs UTSW 4 48,307,823 (GRCm39) missense probably damaging 0.98
R5813:Invs UTSW 4 48,398,146 (GRCm39) missense probably damaging 0.98
R5840:Invs UTSW 4 48,396,284 (GRCm39) missense probably damaging 1.00
R5984:Invs UTSW 4 48,421,674 (GRCm39) missense probably benign 0.00
R6513:Invs UTSW 4 48,397,534 (GRCm39) missense possibly damaging 0.46
R6637:Invs UTSW 4 48,416,203 (GRCm39) splice site probably null
R6667:Invs UTSW 4 48,402,870 (GRCm39) missense possibly damaging 0.66
R6838:Invs UTSW 4 48,283,278 (GRCm39) missense possibly damaging 0.95
R6921:Invs UTSW 4 48,396,260 (GRCm39) missense possibly damaging 0.46
R6945:Invs UTSW 4 48,421,785 (GRCm39) missense probably benign 0.00
R7102:Invs UTSW 4 48,407,674 (GRCm39) missense probably benign 0.21
R7142:Invs UTSW 4 48,407,696 (GRCm39) missense probably damaging 1.00
R7263:Invs UTSW 4 48,396,381 (GRCm39) missense probably damaging 1.00
R7461:Invs UTSW 4 48,392,668 (GRCm39) missense probably damaging 1.00
R7503:Invs UTSW 4 48,396,347 (GRCm39) missense probably damaging 0.96
R7581:Invs UTSW 4 48,421,909 (GRCm39) missense probably benign 0.00
R7613:Invs UTSW 4 48,392,668 (GRCm39) missense probably damaging 1.00
R7861:Invs UTSW 4 48,397,559 (GRCm39) missense possibly damaging 0.50
R8316:Invs UTSW 4 48,426,199 (GRCm39) missense possibly damaging 0.68
R8321:Invs UTSW 4 48,283,267 (GRCm39) missense probably benign 0.13
R8500:Invs UTSW 4 48,422,109 (GRCm39) missense probably damaging 1.00
R8544:Invs UTSW 4 48,397,598 (GRCm39) missense probably damaging 0.96
R9171:Invs UTSW 4 48,398,149 (GRCm39) missense possibly damaging 0.90
R9663:Invs UTSW 4 48,426,218 (GRCm39) missense probably damaging 1.00
X0026:Invs UTSW 4 48,398,221 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCTTCCTGACAAAGCATCCTG -3'
(R):5'- CAGCAAAGTTACTCTGAGCTGC -3'

Sequencing Primer
(F):5'- TTCCACCCTGTCATAGGCACAG -3'
(R):5'- ACTCTGAGCTGCATAGTGC -3'
Posted On 2019-10-14