Mutagenetix > Incidental Mutation

Incidental Mutation 'R7331:Csmd2'

580611

Institutional Source

Beutler Lab

Gene Symbol

Csmd2

Ensembl Gene

ENSMUSG00000028804

Gene Name

CUB and Sushi multiple domains 2

Synonyms

MMRRC Submission

045424-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R7331 (G1)

Quality Score

212.009

Status

Validated

Chromosome

Chromosomal Location

127987857-128567656 bp(+) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

A to T at 128564228 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000184063]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000184063

Predicted Effect

probably null
Transcript: ENSMUST00000221199

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (48/48)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	A	T	13: 77,183,609	H47L	possibly damaging	Het
Adgrf5	T	C	17: 43,437,593	S438P	probably damaging	Het
Atg16l2	C	A	7: 101,299,048	K96N	probably damaging	Het
Bglap2	A	T	3: 88,378,260	M35K	possibly damaging	Het
Btbd1	T	A	7: 81,815,972	I209L	probably damaging	Het
Cdc34	T	C	10: 79,685,312	Y148H	probably damaging	Het
Clcc1	A	G	3: 108,668,078	D157G	probably damaging	Het
Ctsj	G	A	13: 61,003,831	S90L	probably benign	Het
Cycs	A	G	6: 50,565,552	F37L	probably benign	Het
Dync2li1	T	A	17: 84,647,658	C248*	probably null	Het
Dzank1	A	T	2: 144,490,270	I382N	probably benign	Het
Enpp2	T	C	15: 54,875,670	I406V	probably damaging	Het
Ero1lb	A	G	13: 12,600,126	E282G	probably damaging	Het
Fam192a	T	A	8: 94,582,936	K143*	probably null	Het
Fastkd5	A	T	2: 130,615,727	N314K	possibly damaging	Het
Fbxo18	A	T	2: 11,763,986	C300S	probably benign	Het
Fchsd1	T	C	18: 37,968,770	I49V	possibly damaging	Het
Foxn1	A	G	11: 78,358,789	Y637H	probably damaging	Het
Gabarap	A	G	11: 69,994,472	E101G	possibly damaging	Het
Gm5580	G	A	6: 116,552,169	V336I	probably benign	Het
Gm7247	A	G	14: 51,364,335	R22G	probably damaging	Het
Gm7694	A	T	1: 170,301,611	D116E	possibly damaging	Het
Gm9508	A	G	10: 77,696,795	C147R	unknown	Het
Gpr152	A	G	19: 4,142,609	M50V	probably damaging	Het
Hunk	T	A	16: 90,472,562	N331K	possibly damaging	Het
Il1r2	A	G	1: 40,123,249	T351A	probably benign	Het
Iqub	A	G	6: 24,500,394	V287A	possibly damaging	Het
Lix1	A	T	17: 17,427,212	T47S	probably benign	Het
Lrp1b	A	T	2: 40,663,610		probably null	Het
Nup107	G	A	10: 117,770,198	T500I	probably damaging	Het
Phf21b	G	C	15: 84,791,094	R405G	probably benign	Het
Piezo2	A	G	18: 63,108,030	V709A	probably damaging	Het
Rfc1	T	C	5: 65,311,044	T109A	probably damaging	Het
Rpa1	A	G	11: 75,313,115	V302A	probably damaging	Het
Ryr2	A	G	13: 11,745,631	I1522T	probably benign	Het
Ryr3	C	A	2: 112,763,665	R2578L	possibly damaging	Het
Scgb2b18	C	T	7: 33,173,256	W41*	probably null	Het
Sdccag8	C	G	1: 176,868,290	Q387E	possibly damaging	Het
Slc25a17	G	A	15: 81,329,145	T119M	probably damaging	Het
Slc45a4	G	T	15: 73,605,640	Q16K	probably benign	Het
Slc4a1	G	A	11: 102,361,419		probably benign	Het
Slc7a14	T	C	3: 31,257,731	T47A	probably benign	Het
Stard6	A	G	18: 70,483,482	R71G	probably damaging	Het
Tecr	A	G	8: 83,571,935	V321A	probably damaging	Het
Ttc3	T	A	16: 94,394,359	F290L	probably benign	Het
Uqcc1	A	G	2: 155,911,811	V48A	probably benign	Het
V1rd19	T	A	7: 24,003,883	I258N	probably damaging	Het
Zar1	T	A	5: 72,580,312	E249V	possibly damaging	Het
Zfp101	T	C	17: 33,382,585	T66A	possibly damaging	Het
Zyx	A	G	6: 42,351,659	H230R	probably benign	Het

Other mutations in Csmd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Csmd2	APN	4	128483473	missense	probably benign	0.03
IGL01098:Csmd2	APN	4	128059052	missense	probably damaging	0.99
IGL01114:Csmd2	APN	4	128369130	missense	probably benign	0.04
IGL01364:Csmd2	APN	4	128414288	missense	probably benign	0.01
IGL01530:Csmd2	APN	4	128414301	missense	possibly damaging	0.66
IGL01582:Csmd2	APN	4	128563305	nonsense	probably null
IGL01670:Csmd2	APN	4	128513371	splice site	probably benign
IGL01707:Csmd2	APN	4	128383005	missense	possibly damaging	0.81
IGL01810:Csmd2	APN	4	128480845	splice site	probably benign
IGL01837:Csmd2	APN	4	128419570	missense	possibly damaging	0.92
IGL01924:Csmd2	APN	4	128559947	missense	unknown
IGL02013:Csmd2	APN	4	128321323	missense	possibly damaging	0.47
IGL02020:Csmd2	APN	4	128559879	missense	probably damaging	1.00
IGL02037:Csmd2	APN	4	128477470	splice site	probably benign
IGL02303:Csmd2	APN	4	128369008	missense	probably benign	0.01
IGL02317:Csmd2	APN	4	128463727	splice site	probably benign
IGL02322:Csmd2	APN	4	128463727	splice site	probably benign
IGL02338:Csmd2	APN	4	128395066	missense	possibly damaging	0.79
IGL02412:Csmd2	APN	4	128513372	splice site	probably benign
IGL02428:Csmd2	APN	4	128474816	missense	possibly damaging	0.82
IGL02491:Csmd2	APN	4	128534257	missense	probably benign
IGL02701:Csmd2	APN	4	128496141	missense	probably benign	0.17
IGL02801:Csmd2	APN	4	128552075	splice site	probably null
IGL02818:Csmd2	APN	4	128209728	missense	probably damaging	1.00
IGL02863:Csmd2	APN	4	128521884	missense	probably benign	0.00
IGL02876:Csmd2	APN	4	128321335	nonsense	probably null
IGL02977:Csmd2	APN	4	128493276	nonsense	probably null
IGL03006:Csmd2	APN	4	128480765	splice site	probably benign
IGL03032:Csmd2	APN	4	128519041	missense	probably benign	0.03
IGL03148:Csmd2	APN	4	128384269	missense	probably damaging	1.00
IGL03157:Csmd2	APN	4	128414299	nonsense	probably null
IGL03245:Csmd2	APN	4	128509122	missense	probably benign	0.12
IGL03376:Csmd2	APN	4	128517671	missense	probably benign	0.03
IGL03014:Csmd2	UTSW	4	128296429	missense	probably benign	0.01
R0109:Csmd2	UTSW	4	128544743	missense	probably benign	0.03
R0112:Csmd2	UTSW	4	128496029	missense	probably damaging	1.00
R0157:Csmd2	UTSW	4	128521911	missense	probably benign	0.02
R0390:Csmd2	UTSW	4	128133673	intron	probably benign
R0441:Csmd2	UTSW	4	128520230	missense	probably benign	0.00
R0519:Csmd2	UTSW	4	128487005	missense	possibly damaging	0.95
R0743:Csmd2	UTSW	4	128113676	missense	probably benign	0.00
R0746:Csmd2	UTSW	4	128414297	missense	probably damaging	1.00
R0973:Csmd2	UTSW	4	128496188	missense	possibly damaging	0.91
R1019:Csmd2	UTSW	4	128522014	missense	probably benign	0.00
R1476:Csmd2	UTSW	4	128487001	missense	probably benign	0.08
R1641:Csmd2	UTSW	4	128483395	missense	possibly damaging	0.68
R1709:Csmd2	UTSW	4	128496195	missense	probably damaging	0.96
R2866:Csmd2	UTSW	4	128414392	critical splice donor site	probably null
R2870:Csmd2	UTSW	4	128557718	missense	unknown
R2870:Csmd2	UTSW	4	128557718	missense	unknown
R2871:Csmd2	UTSW	4	128557718	missense	unknown
R2871:Csmd2	UTSW	4	128557718	missense	unknown
R2872:Csmd2	UTSW	4	128557718	missense	unknown
R2872:Csmd2	UTSW	4	128557718	missense	unknown
R2873:Csmd2	UTSW	4	128557718	missense	unknown
R2893:Csmd2	UTSW	4	128538993	splice site	probably null
R3796:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3797:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3798:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3914:Csmd2	UTSW	4	128321324	missense	probably benign	0.07
R4198:Csmd2	UTSW	4	128510924	missense	probably benign	0.07
R4489:Csmd2	UTSW	4	128381945	missense	possibly damaging	0.68
R4571:Csmd2	UTSW	4	128480095	splice site	probably null
R4581:Csmd2	UTSW	4	128369088	missense	probably benign	0.02
R4599:Csmd2	UTSW	4	127988128	missense	probably benign	0.35
R4649:Csmd2	UTSW	4	128546073	missense	probably benign
R4706:Csmd2	UTSW	4	128544751	missense	probably benign
R4776:Csmd2	UTSW	4	128442892	missense	probably benign	0.09
R4838:Csmd2	UTSW	4	128517749	missense	probably benign
R4900:Csmd2	UTSW	4	128452525	missense	probably benign	0.03
R4999:Csmd2	UTSW	4	128521930	missense	probably benign	0.00
R5024:Csmd2	UTSW	4	128321348	missense	possibly damaging	0.94
R5034:Csmd2	UTSW	4	128059108	missense	probably damaging	0.98
R5152:Csmd2	UTSW	4	128552035	missense	probably benign	0.27
R5172:Csmd2	UTSW	4	128477397	missense	probably benign	0.10
R5231:Csmd2	UTSW	4	128546049	missense	probably benign	0.00
R5279:Csmd2	UTSW	4	128456914	missense	probably benign	0.30
R5287:Csmd2	UTSW	4	128486884	missense	probably benign	0.01
R5403:Csmd2	UTSW	4	128486884	missense	probably benign	0.01
R5410:Csmd2	UTSW	4	128548819	missense	probably benign
R5551:Csmd2	UTSW	4	128510948	missense	possibly damaging	0.83
R5566:Csmd2	UTSW	4	128462889	critical splice donor site	probably null
R5826:Csmd2	UTSW	4	128519199	splice site	probably null
R5907:Csmd2	UTSW	4	128197385	missense	probably damaging	0.99
R5913:Csmd2	UTSW	4	128551988	missense	probably benign	0.01
R5970:Csmd2	UTSW	4	128546151	missense	probably benign	0.00
R5977:Csmd2	UTSW	4	128059034	missense	probably damaging	1.00
R6027:Csmd2	UTSW	4	128559946	missense	unknown
R6075:Csmd2	UTSW	4	128486865	missense	probably benign	0.15
R6129:Csmd2	UTSW	4	128493334	missense	possibly damaging	0.79
R6363:Csmd2	UTSW	4	128400379	missense	probably benign	0.00
R6366:Csmd2	UTSW	4	128483452	missense	probably benign	0.00
R6404:Csmd2	UTSW	4	128521950	missense	possibly damaging	0.90
R6437:Csmd2	UTSW	4	127988100	missense	probably benign	0.24
R6441:Csmd2	UTSW	4	128394964	missense	probably benign	0.03
R6643:Csmd2	UTSW	4	128372597	missense	probably benign	0.14
R6724:Csmd2	UTSW	4	128563371	missense	probably damaging	0.97
R6734:Csmd2	UTSW	4	128463813	missense	probably benign	0.00
R6750:Csmd2	UTSW	4	128197225	missense	possibly damaging	0.91
R6801:Csmd2	UTSW	4	128383950	missense	probably benign	0.11
R6842:Csmd2	UTSW	4	128509159	missense	possibly damaging	0.72
R6843:Csmd2	UTSW	4	128463794	missense	probably benign	0.27
R6868:Csmd2	UTSW	4	128442840	missense	probably benign
R6882:Csmd2	UTSW	4	128449269	missense	probably benign	0.01
R7019:Csmd2	UTSW	4	128369063	missense
R7028:Csmd2	UTSW	4	128277228	missense
R7096:Csmd2	UTSW	4	128462726	missense
R7122:Csmd2	UTSW	4	128449227	missense
R7125:Csmd2	UTSW	4	128496162	missense
R7197:Csmd2	UTSW	4	128511033	missense
R7234:Csmd2	UTSW	4	128456779	missense
R7299:Csmd2	UTSW	4	128528262	missense
R7301:Csmd2	UTSW	4	128528262	missense
R7319:Csmd2	UTSW	4	128393679	missense
R7332:Csmd2	UTSW	4	128419567	missense
R7352:Csmd2	UTSW	4	128557636	missense
R7402:Csmd2	UTSW	4	128322095	missense
R7402:Csmd2	UTSW	4	128322096	missense
R7474:Csmd2	UTSW	4	128546127	missense
R7555:Csmd2	UTSW	4	128452458	missense
R7592:Csmd2	UTSW	4	128463798	missense
R7700:Csmd2	UTSW	4	128545756	splice site	probably null
R7714:Csmd2	UTSW	4	128382950	nonsense	probably null
R7734:Csmd2	UTSW	4	128552057	missense
R7735:Csmd2	UTSW	4	128456930	critical splice donor site	probably null
R7757:Csmd2	UTSW	4	128483456	missense
R7805:Csmd2	UTSW	4	128419573	missense
R7823:Csmd2	UTSW	4	128209905	missense
R7904:Csmd2	UTSW	4	128419553	missense
R7946:Csmd2	UTSW	4	128520265	missense
R7964:Csmd2	UTSW	4	128523510	missense
R7968:Csmd2	UTSW	4	128197325	missense
R8003:Csmd2	UTSW	4	128539187	nonsense	probably null
R8071:Csmd2	UTSW	4	128393538	missense
R8504:Csmd2	UTSW	4	128546690	missense
R8511:Csmd2	UTSW	4	128368899	missense
R8517:Csmd2	UTSW	4	128552686	missense
R8704:Csmd2	UTSW	4	128197354	missense
R8722:Csmd2	UTSW	4	128551950	unclassified	probably benign
R8729:Csmd2	UTSW	4	128462845	missense
R8801:Csmd2	UTSW	4	128563402	missense	probably damaging	0.97
R8803:Csmd2	UTSW	4	128546684	missense
R8839:Csmd2	UTSW	4	128442888	missense
R8867:Csmd2	UTSW	4	128557676	missense
R8913:Csmd2	UTSW	4	128523558	missense
R8928:Csmd2	UTSW	4	128475789	missense
R8974:Csmd2	UTSW	4	128552587	missense
R9001:Csmd2	UTSW	4	128414286	missense
R9132:Csmd2	UTSW	4	128549214	missense
R9245:Csmd2	UTSW	4	128306375	missense
R9249:Csmd2	UTSW	4	128419530	nonsense	probably null
R9254:Csmd2	UTSW	4	128197319	missense
R9265:Csmd2	UTSW	4	128400370	missense
R9407:Csmd2	UTSW	4	128548820	missense
R9432:Csmd2	UTSW	4	128277211	missense
R9559:Csmd2	UTSW	4	128544768	missense
R9673:Csmd2	UTSW	4	128414269	missense
R9735:Csmd2	UTSW	4	128509108	missense
R9749:Csmd2	UTSW	4	128496128	missense
R9803:Csmd2	UTSW	4	128369193	missense
Z1177:Csmd2	UTSW	4	128530797	missense

Predicted Primers

PCR Primer
(F):5'- TGCGGGCCACATTTGAGAAC -3'
(R):5'- TGGGTCAGCTTTCCTATTGC -3'

Sequencing Primer
(F):5'- TTTGAGAACCCCATGTATGACCG -3'
(R):5'- GCAGTTCGGATTCTGACCCAC -3'

Posted On

2019-10-14