Mutagenetix > Incidental Mutation

Incidental Mutation 'R0633:Cftr'

58062

Institutional Source

Beutler Lab

Gene Symbol

Cftr

Ensembl Gene

ENSMUSG00000041301

Gene Name

cystic fibrosis transmembrane conductance regulator

Synonyms

Abcc7

MMRRC Submission

038822-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.241) question?

Stock #

R0633 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18170687-18322768 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 18305980 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 1255 (I1255K)

Ref Sequence

ENSEMBL: ENSMUSP00000111065 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045706] [ENSMUST00000115405] [ENSMUST00000115406] [ENSMUST00000140407]

AlphaFold

P26361

Predicted Effect

probably damaging
Transcript: ENSMUST00000045706
AA Change: I1285K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000049228
Gene: ENSMUSG00000041301
AA Change: I1285K

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	3.7e-40	PFAM
AAA	450	623	2.16e-12	SMART
Pfam:CFTR_R	639	844	2e-93	PFAM
Pfam:ABC_membrane	857	1142	2.7e-53	PFAM
AAA	1232	1414	9.94e-12	SMART
low complexity region	1465	1474	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115405

SMART Domains

Protein: ENSMUSP00000111064
Gene: ENSMUSG00000041301

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	1.4e-48	PFAM
Pfam:ABC_tran	441	570	2.3e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115406
AA Change: I1255K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: I1255K

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	167	4e-14	PFAM
Pfam:ABC_membrane	162	320	2.5e-20	PFAM
AAA	420	593	2.16e-12	SMART
Pfam:CFTR_R	609	815	1.3e-97	PFAM
Pfam:ABC_membrane	827	1112	1e-50	PFAM
AAA	1202	1384	9.94e-12	SMART
low complexity region	1435	1444	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140407

SMART Domains

Protein: ENSMUSP00000116957
Gene: ENSMUSG00000041301

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	81	350	1.2e-48	PFAM
Pfam:ABC_tran	441	568	6.3e-20	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.4%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This gene encodes the cystic fibrosis transmembrane regulator and a chloride channel that controls the regulation of other transport pathways. Mutations in this gene have been associated with autosomal recessive disorders such as cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternative splicing of exons 4, 5, and 11 have been observed, but full-length transcripts have not yet been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high mortality associated with intestinal obstruction, and altered mucous and serous glands. Mutants, like humans with cystic fibrosis, also exhibit defective epithelial chloride transport. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	T	6: 149,325,701	I82L	probably benign	Het
4921530L21Rik	T	G	14: 95,881,943	N45K	probably damaging	Het
4933408B17Rik	A	G	18: 34,586,266	V167A	possibly damaging	Het
Adamts8	A	T	9: 30,943,511	R18S	probably damaging	Het
Adgb	G	A	10: 10,391,729	A923V	probably benign	Het
Aldh1a3	A	G	7: 66,400,222	V416A	probably damaging	Het
Alox5	C	T	6: 116,420,384	G280R	probably damaging	Het
Anapc5	A	T	5: 122,800,632	Y360N	probably damaging	Het
Apbb1	C	T	7: 105,558,963	V685I	probably damaging	Het
Apc2	C	A	10: 80,307,455	A463E	probably damaging	Het
Arhgap21	C	T	2: 20,855,387	W1170*	probably null	Het
Atat1	G	A	17: 35,901,423	R305C	probably damaging	Het
Cars2	T	C	8: 11,550,511	D56G	probably benign	Het
Cdc42bpb	T	C	12: 111,345,555	I108V	probably damaging	Het
Ckap5	T	C	2: 91,550,743	L148P	probably damaging	Het
Cntn4	A	G	6: 106,679,248		probably null	Het
Cpe	G	A	8: 64,609,203	P273L	probably damaging	Het
Cpsf7	A	G	19: 10,531,782	D19G	probably benign	Het
Ddx25	C	A	9: 35,545,972	R349L	probably damaging	Het
Depdc7	T	C	2: 104,722,881	D446G	probably benign	Het
Det1	T	A	7: 78,843,935	N107I	probably benign	Het
Dock6	A	T	9: 21,844,417	D170E	probably benign	Het
Dvl1	C	T	4: 155,858,295	L673F	probably damaging	Het
Gucy1b1	A	T	3: 82,045,460	I222K	probably benign	Het
Hfm1	T	C	5: 106,917,601	T71A	possibly damaging	Het
Ikzf1	A	G	11: 11,769,223	E310G	probably damaging	Het
Impg1	T	C	9: 80,394,155	E163G	possibly damaging	Het
Itpr2	G	T	6: 146,374,456	H426Q	probably damaging	Het
Itpripl2	C	T	7: 118,490,256	G360D	probably benign	Het
Kif14	C	T	1: 136,527,305	R1572C	probably damaging	Het
L3mbtl3	A	T	10: 26,302,685	H568Q	unknown	Het
Lgi2	A	G	5: 52,554,460	Y173H	probably damaging	Het
Lpar5	A	C	6: 125,081,991	Y225S	probably benign	Het
Lpin3	A	G	2: 160,903,974	H675R	probably damaging	Het
Lrp2	C	A	2: 69,448,120	G3963V	probably damaging	Het
Man1a2	G	T	3: 100,684,575	D13E	possibly damaging	Het
Map1a	T	C	2: 121,308,014	V2753A	probably damaging	Het
Mitf	C	A	6: 98,003,904	N97K	probably damaging	Het
Msh2	A	G	17: 87,672,810		probably null	Het
Msr1	T	C	8: 39,620,000	E170G	probably damaging	Het
Myrip	C	A	9: 120,388,236	R79S	probably damaging	Het
Nek10	G	A	14: 14,857,782		probably null	Het
Neto1	C	T	18: 86,404,729	R104*	probably null	Het
Nom1	A	C	5: 29,451,100	K821T	probably damaging	Het
Nrxn1	A	G	17: 90,704,181	V340A	probably damaging	Het
Nxpe4	A	T	9: 48,396,597	I334F	probably benign	Het
Olfr1043	T	A	2: 86,162,091	N286I	probably damaging	Het
Olfr1065	C	T	2: 86,445,129	M284I	probably benign	Het
Olfr1247	T	C	2: 89,609,374	M243V	probably benign	Het
Olfr1489	T	C	19: 13,633,336	V75A	probably damaging	Het
Olfr382	A	G	11: 73,516,927	S91P	probably benign	Het
Olfr705	T	C	7: 106,713,977	K235E	probably benign	Het
Padi4	A	G	4: 140,757,585	S322P	probably damaging	Het
Peli3	A	G	19: 4,941,782	Y44H	probably damaging	Het
Prdm4	A	G	10: 85,907,903	S163P	probably damaging	Het
Prom2	T	C	2: 127,539,525	D227G	probably benign	Het
Ptgfr	C	T	3: 151,801,763	R321H	probably benign	Het
Rgs3	G	A	4: 62,625,906	R136H	probably damaging	Het
Rgsl1	T	G	1: 153,844,107	N3T	possibly damaging	Het
Rif1	T	C	2: 52,112,563	S2010P	probably benign	Het
Rngtt	T	C	4: 33,368,690	F408L	probably damaging	Het
Rtn3	T	G	19: 7,457,593	T326P	probably benign	Het
Slc18b1	A	C	10: 23,806,038	M167L	probably benign	Het
Slc22a26	A	G	19: 7,788,210		probably null	Het
Slitrk6	T	C	14: 110,751,885	D130G	probably damaging	Het
Snap47	A	G	11: 59,428,613	V233A	probably benign	Het
Sumf1	A	C	6: 108,144,671	Y158D	probably damaging	Het
Tbc1d15	A	T	10: 115,220,310	H252Q	probably benign	Het
Thsd7b	T	C	1: 130,188,526	S1339P	possibly damaging	Het
Tmem45a2	T	C	16: 57,049,414	I56V	probably benign	Het
Ttc21b	A	G	2: 66,236,233	S359P	probably benign	Het
Ttc27	T	C	17: 74,729,977	I215T	probably benign	Het
Ttn	C	T	2: 76,724,195	V30759I	possibly damaging	Het
Vdac3	T	C	8: 22,580,388	N168S	probably damaging	Het
Wdr7	T	C	18: 63,865,300	V1106A	probably benign	Het
Wrap73	T	A	4: 154,142,491	F16Y	probably damaging	Het
Zfat	C	A	15: 68,180,803	D381Y	probably damaging	Het

Other mutations in Cftr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00901:Cftr	APN	6	18268430	critical splice donor site	probably null
IGL01082:Cftr	APN	6	18226103	missense	probably damaging	0.97
IGL01113:Cftr	APN	6	18270253	missense	probably damaging	1.00
IGL01383:Cftr	APN	6	18226041	missense	probably benign	0.00
IGL01595:Cftr	APN	6	18198239	splice site	probably benign
IGL01820:Cftr	APN	6	18226139	missense	probably damaging	1.00
IGL02223:Cftr	APN	6	18221482	missense	probably damaging	1.00
IGL02249:Cftr	APN	6	18277871	missense	possibly damaging	0.58
IGL02439:Cftr	APN	6	18258238	nonsense	probably null
IGL02537:Cftr	APN	6	18274597	missense	probably benign	0.31
IGL03234:Cftr	APN	6	18225988	missense	probably damaging	0.96
BB004:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
BB014:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
PIT4453001:Cftr	UTSW	6	18214106	missense	probably damaging	0.99
PIT4520001:Cftr	UTSW	6	18277843	missense	probably benign	0.01
R0114:Cftr	UTSW	6	18282448	missense	probably damaging	1.00
R0329:Cftr	UTSW	6	18226097	missense	probably null	1.00
R0330:Cftr	UTSW	6	18226097	missense	probably null	1.00
R0331:Cftr	UTSW	6	18235226	missense	possibly damaging	0.72
R0480:Cftr	UTSW	6	18274518	splice site	probably benign
R0612:Cftr	UTSW	6	18198126	missense	probably benign	0.01
R0830:Cftr	UTSW	6	18270225	missense	probably benign	0.02
R1559:Cftr	UTSW	6	18225937	missense	probably benign	0.01
R1629:Cftr	UTSW	6	18226106	missense	probably damaging	1.00
R1636:Cftr	UTSW	6	18226157	missense	probably damaging	0.99
R1860:Cftr	UTSW	6	18268289	missense	probably benign	0.00
R2043:Cftr	UTSW	6	18320935	missense	probably benign
R2211:Cftr	UTSW	6	18214280	missense	probably null	0.13
R4737:Cftr	UTSW	6	18299883	missense	probably benign	0.19
R4793:Cftr	UTSW	6	18226088	missense	probably damaging	1.00
R4857:Cftr	UTSW	6	18320975	missense	possibly damaging	0.92
R4984:Cftr	UTSW	6	18235199	missense	possibly damaging	0.89
R4999:Cftr	UTSW	6	18221614	missense	probably benign	0.17
R5045:Cftr	UTSW	6	18230081	missense	probably benign	0.20
R5183:Cftr	UTSW	6	18299833	missense	probably damaging	0.99
R5197:Cftr	UTSW	6	18255414	missense	probably benign	0.00
R5288:Cftr	UTSW	6	18226129	nonsense	probably null
R5337:Cftr	UTSW	6	18319059	missense	probably damaging	1.00
R5549:Cftr	UTSW	6	18227954	missense	probably benign	0.00
R5596:Cftr	UTSW	6	18268096	missense	probably benign	0.00
R5651:Cftr	UTSW	6	18255365	splice site	probably null
R5660:Cftr	UTSW	6	18313687	missense	probably benign	0.22
R5941:Cftr	UTSW	6	18313646	missense	probably damaging	1.00
R6221:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6222:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6229:Cftr	UTSW	6	18220684	missense	probably damaging	1.00
R6256:Cftr	UTSW	6	18274661	missense	probably damaging	0.96
R6257:Cftr	UTSW	6	18282501	missense	probably benign	0.00
R6412:Cftr	UTSW	6	18285604	missense	probably damaging	0.97
R6459:Cftr	UTSW	6	18258236	missense	probably damaging	1.00
R6558:Cftr	UTSW	6	18222528	missense	probably damaging	1.00
R6724:Cftr	UTSW	6	18255974	nonsense	probably null
R6787:Cftr	UTSW	6	18274608	nonsense	probably null
R6861:Cftr	UTSW	6	18268108	missense	probably benign	0.00
R6888:Cftr	UTSW	6	18313730	critical splice donor site	probably null
R7084:Cftr	UTSW	6	18226138	missense	probably benign	0.17
R7105:Cftr	UTSW	6	18318972	missense	probably damaging	1.00
R7320:Cftr	UTSW	6	18319013	missense	probably damaging	0.97
R7359:Cftr	UTSW	6	18221624	missense	probably benign	0.00
R7466:Cftr	UTSW	6	18227973	missense	probably benign
R7502:Cftr	UTSW	6	18214296	missense	probably damaging	1.00
R7748:Cftr	UTSW	6	18277889	critical splice donor site	probably null
R7808:Cftr	UTSW	6	18204205	missense	probably benign
R7817:Cftr	UTSW	6	18267968	missense	probably damaging	0.97
R7927:Cftr	UTSW	6	18267971	missense	possibly damaging	0.81
R7968:Cftr	UTSW	6	18226049	missense	probably benign	0.00
R7995:Cftr	UTSW	6	18214156	missense	probably damaging	1.00
R8171:Cftr	UTSW	6	18258288	missense	probably damaging	1.00
R8210:Cftr	UTSW	6	18220697	missense	probably damaging	1.00
R8548:Cftr	UTSW	6	18273699	missense	possibly damaging	0.87
R8712:Cftr	UTSW	6	18274697	missense	probably damaging	0.99
R8737:Cftr	UTSW	6	18319729	missense	probably damaging	1.00
R8926:Cftr	UTSW	6	18268004	missense	possibly damaging	0.83
R8979:Cftr	UTSW	6	18227948	missense	probably benign	0.10
R8996:Cftr	UTSW	6	18255946	nonsense	probably null
R9087:Cftr	UTSW	6	18214181	missense	possibly damaging	0.91
R9115:Cftr	UTSW	6	18235311	missense	probably damaging	1.00
R9406:Cftr	UTSW	6	18299867	missense	probably benign	0.00
R9689:Cftr	UTSW	6	18313650	missense	probably damaging	0.99
R9700:Cftr	UTSW	6	18268360	missense	probably damaging	1.00
R9747:Cftr	UTSW	6	18285637	missense	possibly damaging	0.52

Predicted Primers

PCR Primer
(F):5'- GCTCCATGAGAAGAGAACCCATTCC -3'
(R):5'- ACCCAGGCTGCTGTTACAGATTG -3'

Sequencing Primer
(F):5'- CCTTGGTGCAAGAGTAATGCC -3'
(R):5'- CAGATTGTGCTTTGGGAGAACAC -3'

Posted On

2013-07-11