Incidental Mutation 'R7344:Slc35d1'
ID580621
Institutional Source Beutler Lab
Gene Symbol Slc35d1
Ensembl Gene ENSMUSG00000028521
Gene Namesolute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1
SynonymsUGTREL7
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7344 (G1)
Quality Score131.008
Status Validated
Chromosome4
Chromosomal Location103170649-103215164 bp(-) (GRCm38)
Type of Mutationintron (119 bp from exon)
DNA Base Change (assembly) A to T at 103213046 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036195] [ENSMUST00000150285] [ENSMUST00000183432]
Predicted Effect probably null
Transcript: ENSMUST00000036195
SMART Domains Protein: ENSMUSP00000037617
Gene: ENSMUSG00000028521

DomainStartEndE-ValueType
Pfam:TPT 18 307 6.4e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000150285
SMART Domains Protein: ENSMUSP00000122124
Gene: ENSMUSG00000028521

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 69 88 N/A INTRINSIC
transmembrane domain 158 177 N/A INTRINSIC
transmembrane domain 187 205 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 259 281 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183432
SMART Domains Protein: ENSMUSP00000138926
Gene: ENSMUSG00000028521

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 50 69 N/A INTRINSIC
transmembrane domain 111 133 N/A INTRINSIC
transmembrane domain 138 157 N/A INTRINSIC
transmembrane domain 167 184 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosylation of cellular glycoconjugates occurs in the endoplasmic reticulum (ER) and Golgi compartment, and requires transport of nucleotide sugars from the cytosol into the lumen of the ER and Golgi by specific transporters. The protein encoded by this gene resides in the ER, and transports both UDP-glucuronic acid (UDP-GlcA) and UDP-N-acetylgalactosamine (UDP-GalNAc) from the cytoplasm to the ER lumen. It may participate in glucuronidation and/or chondroitin sulfate biosynthesis. Mutations in this gene are associated with Schneckenbecken dysplasia.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality and chondrodystrophy associated with impaired chondroitin sulfate biosynthesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930438A08Rik A C 11: 58,291,447 Y216S Het
9530053A07Rik T C 7: 28,140,279 S506P possibly damaging Het
9530053A07Rik C T 7: 28,152,760 T1236I possibly damaging Het
AI314180 A T 4: 58,824,770 D1070E probably benign Het
Anpep G T 7: 79,838,650 S477R possibly damaging Het
Atp7b T C 8: 21,997,499 D1293G probably damaging Het
Caprin2 A G 6: 148,873,067 V249A probably benign Het
Cep41 C T 6: 30,693,656 R5K probably benign Het
Cyp2c23 A T 19: 44,021,737 probably null Het
Dazap2 T A 15: 100,616,943 V15E possibly damaging Het
Epha8 T A 4: 136,934,538 H582L probably benign Het
Fam193a A G 5: 34,485,730 T1513A possibly damaging Het
Fancd2 T C 6: 113,568,709 V901A probably benign Het
Fbl T A 7: 28,178,935 V284E probably damaging Het
Fbln2 A G 6: 91,269,973 E1065G probably damaging Het
Fbxw16 A G 9: 109,449,035 V25A probably benign Het
Gm11562 T G 11: 99,620,369 T2P unknown Het
Gm17728 G T 17: 9,422,123 G22W probably damaging Het
Gm30083 A G 14: 33,999,580 Y190H probably benign Het
Gm6793 T A 8: 112,014,929 D27V probably damaging Het
Gm7324 A G 14: 43,714,677 D259G probably benign Het
Gtf2a1l G A 17: 88,694,103 G129D probably damaging Het
Ildr2 T A 1: 166,294,597 V203E probably damaging Het
Ipo4 C T 14: 55,635,531 R23Q probably benign Het
Irx5 A G 8: 92,359,555 T89A probably benign Het
Itga7 A G 10: 128,940,929 N221S possibly damaging Het
Lpcat2 T C 8: 92,875,567 W259R probably damaging Het
Lrrc8e C T 8: 4,234,815 R347C probably damaging Het
Lyst T A 13: 13,706,555 D2790E probably benign Het
Magi2 G A 5: 20,550,240 R604Q probably benign Het
Mertk C A 2: 128,771,497 H478N probably benign Het
Mical3 T A 6: 121,036,544 K293* probably null Het
Nod2 T C 8: 88,660,582 L168P probably damaging Het
Npnt T C 3: 132,908,339 probably null Het
Olfr1006 A T 2: 85,674,931 Y73* probably null Het
Olfr1375 T G 11: 51,048,295 F63V probably damaging Het
Olfr312 A T 11: 58,831,482 E109D probably damaging Het
Olfr884 T C 9: 38,047,957 M245T probably benign Het
Plcd4 A T 1: 74,554,652 D312V probably damaging Het
Prss58 A G 6: 40,895,465 I208T probably damaging Het
Pus7l A G 15: 94,540,617 S116P probably benign Het
Rcc1l A T 5: 134,176,437 I93N probably benign Het
Rftn2 A C 1: 55,226,152 Y36* probably null Het
Rp1l1 G A 14: 64,029,620 R885Q probably benign Het
Rpgrip1 A T 14: 52,140,659 D488V probably damaging Het
Sacs A G 14: 61,207,444 Y2313C possibly damaging Het
Scrib T C 15: 76,049,258 Y1332C probably damaging Het
Serpinb10 T C 1: 107,540,942 V105A probably damaging Het
Slfn3 T C 11: 83,212,822 V173A probably benign Het
Smpd3 C T 8: 106,265,193 V243M probably damaging Het
Stard9 A T 2: 120,704,686 D3808V possibly damaging Het
Supt16 A T 14: 52,173,571 V692D probably damaging Het
Tapt1 A T 5: 44,188,657 V317E probably damaging Het
Vmn2r101 T C 17: 19,611,797 I685T probably benign Het
Vmn2r92 A G 17: 18,167,251 I173V probably benign Het
Vps54 T C 11: 21,274,999 I165T probably damaging Het
Zswim4 G A 8: 84,223,698 R628* probably null Het
Zzz3 T C 3: 152,452,099 S770P probably damaging Het
Other mutations in Slc35d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Slc35d1 APN 4 103211325 missense probably benign 0.00
IGL03198:Slc35d1 APN 4 103184888 missense probably damaging 1.00
R0131:Slc35d1 UTSW 4 103208181 missense probably benign 0.01
R0131:Slc35d1 UTSW 4 103208181 missense probably benign 0.01
R0132:Slc35d1 UTSW 4 103208181 missense probably benign 0.01
R0206:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R0206:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R0208:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R0270:Slc35d1 UTSW 4 103190838 missense probably damaging 0.98
R0346:Slc35d1 UTSW 4 103190847 missense probably damaging 0.96
R0388:Slc35d1 UTSW 4 103184887 nonsense probably null
R0638:Slc35d1 UTSW 4 103213244 splice site probably benign
R2146:Slc35d1 UTSW 4 103205152 missense probably damaging 0.99
R3722:Slc35d1 UTSW 4 103208124 missense possibly damaging 0.93
R4649:Slc35d1 UTSW 4 103213229 missense probably damaging 1.00
R5137:Slc35d1 UTSW 4 103214781 missense possibly damaging 0.71
R5327:Slc35d1 UTSW 4 103213186 missense probably damaging 1.00
R5351:Slc35d1 UTSW 4 103189839 missense probably damaging 1.00
R5395:Slc35d1 UTSW 4 103211375 critical splice acceptor site probably null
R6263:Slc35d1 UTSW 4 103208168 missense possibly damaging 0.93
R6470:Slc35d1 UTSW 4 103189822 missense probably damaging 1.00
R7388:Slc35d1 UTSW 4 103189785 critical splice donor site probably null
R7580:Slc35d1 UTSW 4 103208133 missense
R7729:Slc35d1 UTSW 4 103214847 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACAAATCTTTCTCCGTGGC -3'
(R):5'- ACAGAGCTGTTTCTCTTTGCTG -3'

Sequencing Primer
(F):5'- GTGGCAGGTTCCCCCAAAAC -3'
(R):5'- TCCACTACCTCTACTATATTTTGGG -3'
Posted On2019-10-14