Incidental Mutation 'R7263:Spef2'
ID580630
Institutional Source Beutler Lab
Gene Symbol Spef2
Ensembl Gene ENSMUSG00000072663
Gene Namesperm flagellar 2
SynonymsC230086A09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R7263 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location9578193-9748868 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) T to G at 9653012 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160236] [ENSMUST00000208854]
Predicted Effect probably null
Transcript: ENSMUST00000160236
SMART Domains Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663

DomainStartEndE-ValueType
Pfam:DUF1042 5 160 4.6e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 787 3.7e-10 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1225 N/A INTRINSIC
low complexity region 1254 1268 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
SCOP:d1rec__ 1368 1520 3e-3 SMART
low complexity region 1595 1614 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000208854
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (67/70)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 122,054,194 H55N probably damaging Het
Acan G T 7: 79,092,318 V488L probably damaging Het
Adam12 T C 7: 133,919,511 E638G possibly damaging Het
Adamts20 T A 15: 94,322,891 Q1387L possibly damaging Het
Adamts3 G T 5: 89,677,742 D1079E probably benign Het
Barx1 G T 13: 48,665,079 G93C probably damaging Het
Carmil2 C T 8: 105,693,045 R828C probably damaging Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc159 T C 9: 21,931,711 M148T probably benign Het
Cdk5rap1 T A 2: 154,360,732 N193Y probably benign Het
Csnk1g2 G A 10: 80,634,498 G15D probably damaging Het
Dach1 T C 14: 98,168,859 S151G probably benign Het
Elf5 C A 2: 103,439,300 N75K probably benign Het
Elp3 T C 14: 65,565,333 D272G probably damaging Het
Epb41l1 T A 2: 156,495,123 probably null Het
Epha6 A G 16: 59,775,665 Y888H probably damaging Het
Fibcd1 T C 2: 31,817,210 Y345C probably damaging Het
Gjc1 C T 11: 102,800,137 E347K possibly damaging Het
Gm16486 A G 8: 70,710,776 N873D possibly damaging Het
Gse1 A G 8: 120,574,171 D892G unknown Het
Gtpbp6 A T 5: 110,104,049 I506N probably benign Het
Hivep1 T A 13: 42,158,192 F1303I possibly damaging Het
Il21r A G 7: 125,632,905 T502A probably benign Het
Ints1 T C 5: 139,764,079 T997A possibly damaging Het
Invs C A 4: 48,396,381 N351K probably damaging Het
Iqcm A G 8: 75,763,073 T390A probably benign Het
Kcnh4 C T 11: 100,741,817 G948D probably benign Het
Kcnh7 T A 2: 62,735,970 probably null Het
Lrrc72 A G 12: 36,208,612 V82A probably damaging Het
Macf1 A T 4: 123,378,150 L6535Q probably damaging Het
Ncor2 G C 5: 125,032,132 L585V Het
Nipal2 G C 15: 34,578,758 Y298* probably null Het
Nipsnap1 C T 11: 4,882,960 probably benign Het
Olfr1112 T A 2: 87,192,132 C148* probably null Het
Olfr1267-ps1 T C 2: 90,085,988 I158V not run Het
Olfr578 A T 7: 102,984,317 Y282* probably null Het
Pcdhga4 C T 18: 37,686,820 T474I probably benign Het
Pdp1 G T 4: 11,960,821 Q516K possibly damaging Het
Pik3c2b C T 1: 133,090,202 P934L probably damaging Het
Pp2d1 A G 17: 53,515,330 I236T probably benign Het
Pygm G A 19: 6,388,327 R278H probably damaging Het
Rb1 A T 14: 73,282,923 C215* probably null Het
Rgs22 A G 15: 36,015,643 S1156P possibly damaging Het
Rgs9bp T C 7: 35,584,701 T174A probably damaging Het
Rnf133 A T 6: 23,649,668 Y130* probably null Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Serpinb6e A T 13: 33,838,940 F153L probably benign Het
Slc22a1 A T 17: 12,666,700 Y200N probably damaging Het
Slc22a22 C A 15: 57,249,711 M377I probably benign Het
Slc36a4 A G 9: 15,722,156 probably null Het
Slc39a6 A G 18: 24,601,203 V143A probably benign Het
Slf2 G A 19: 44,938,424 probably null Het
Sowaha T C 11: 53,479,658 K84E probably benign Het
Sphkap A T 1: 83,276,678 F1117I probably damaging Het
Tas2r113 T C 6: 132,893,576 I189T possibly damaging Het
Tescl T C 7: 24,333,822 E26G possibly damaging Het
Trpm6 A T 19: 18,876,786 I1847F probably damaging Het
Uba1y T A Y: 822,200 C178S possibly damaging Het
Ush2a T A 1: 188,443,329 V1208D possibly damaging Het
Usp13 G C 3: 32,894,851 A446P probably damaging Het
Usp7 A T 16: 8,696,724 C722S possibly damaging Het
Vmn1r52 A G 6: 90,179,553 S280G probably benign Het
Vmn2r84 T C 10: 130,389,208 K478E probably damaging Het
Zfp112 C A 7: 24,125,527 L311I probably benign Het
Zfp180 G T 7: 24,105,700 E515* probably null Het
Zfp518b A G 5: 38,672,328 I778T probably damaging Het
Zfp800 A T 6: 28,243,663 H434Q probably benign Het
Other mutations in Spef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Spef2 APN 15 9740535 missense probably damaging 1.00
IGL00886:Spef2 APN 15 9663095 missense probably damaging 1.00
IGL01409:Spef2 APN 15 9716413 missense probably damaging 1.00
IGL01413:Spef2 APN 15 9676290 missense probably benign 0.16
IGL01474:Spef2 APN 15 9663158 missense probably benign 0.00
IGL01603:Spef2 APN 15 9704380 missense probably damaging 0.99
IGL02320:Spef2 APN 15 9717576 missense probably damaging 0.99
IGL02570:Spef2 APN 15 9717498 nonsense probably null
IGL02605:Spef2 APN 15 9725152 missense probably damaging 0.99
IGL02890:Spef2 APN 15 9748767 start codon destroyed probably null 1.00
IGL02904:Spef2 APN 15 9679346 missense probably damaging 1.00
IGL02942:Spef2 APN 15 9668874 missense possibly damaging 0.71
IGL02953:Spef2 APN 15 9713243 missense possibly damaging 0.82
IGL02965:Spef2 APN 15 9725106 splice site probably benign
IGL03263:Spef2 APN 15 9667219 missense possibly damaging 0.72
IGL03302:Spef2 APN 15 9676380 missense probably benign 0.01
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0183:Spef2 UTSW 15 9716359 missense possibly damaging 0.70
R0386:Spef2 UTSW 15 9584062 missense probably damaging 1.00
R0511:Spef2 UTSW 15 9583984 critical splice donor site probably null
R0617:Spef2 UTSW 15 9592758 missense probably damaging 1.00
R0655:Spef2 UTSW 15 9626131 missense possibly damaging 0.96
R0829:Spef2 UTSW 15 9687813 missense probably benign 0.10
R0908:Spef2 UTSW 15 9614195 splice site probably null
R0939:Spef2 UTSW 15 9704550 splice site probably null
R0973:Spef2 UTSW 15 9716396 missense probably damaging 1.00
R1371:Spef2 UTSW 15 9725108 splice site probably benign
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1428:Spef2 UTSW 15 9596707 unclassified probably benign
R1518:Spef2 UTSW 15 9667230 missense probably damaging 1.00
R1585:Spef2 UTSW 15 9596574 missense probably damaging 1.00
R1654:Spef2 UTSW 15 9634652 missense probably damaging 0.99
R1723:Spef2 UTSW 15 9614209 missense probably damaging 1.00
R1757:Spef2 UTSW 15 9717482 missense probably damaging 1.00
R1812:Spef2 UTSW 15 9679349 missense probably damaging 1.00
R1817:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1818:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1873:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9597401 missense possibly damaging 0.78
R1897:Spef2 UTSW 15 9729654 nonsense probably null
R1901:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1902:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1943:Spef2 UTSW 15 9663194 missense possibly damaging 0.76
R1968:Spef2 UTSW 15 9609516 missense probably damaging 1.00
R1973:Spef2 UTSW 15 9663066 makesense probably null
R1998:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R1999:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R2008:Spef2 UTSW 15 9713185 missense possibly damaging 0.95
R2111:Spef2 UTSW 15 9589573 missense probably damaging 1.00
R2127:Spef2 UTSW 15 9729661 missense possibly damaging 0.53
R2405:Spef2 UTSW 15 9626034 nonsense probably null
R2517:Spef2 UTSW 15 9725197 missense possibly damaging 0.93
R2889:Spef2 UTSW 15 9630613 missense probably damaging 0.99
R2988:Spef2 UTSW 15 9682623 missense probably benign 0.43
R3792:Spef2 UTSW 15 9704536 missense probably damaging 1.00
R4154:Spef2 UTSW 15 9626021 missense probably benign 0.13
R4159:Spef2 UTSW 15 9676321 missense probably damaging 1.00
R4199:Spef2 UTSW 15 9667280 missense probably damaging 1.00
R4320:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4321:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4568:Spef2 UTSW 15 9647217 missense probably damaging 1.00
R4625:Spef2 UTSW 15 9647438 missense probably damaging 1.00
R4669:Spef2 UTSW 15 9676373 missense probably benign 0.42
R4684:Spef2 UTSW 15 9647490 missense probably benign 0.44
R4761:Spef2 UTSW 15 9652954 missense probably damaging 1.00
R4839:Spef2 UTSW 15 9713178 nonsense probably null
R5004:Spef2 UTSW 15 9578327 missense probably benign 0.02
R5157:Spef2 UTSW 15 9668791 nonsense probably null
R5230:Spef2 UTSW 15 9667230 missense possibly damaging 0.62
R5315:Spef2 UTSW 15 9596691 missense probably damaging 0.98
R5400:Spef2 UTSW 15 9614281 missense probably damaging 1.00
R5591:Spef2 UTSW 15 9583836 missense probably benign 0.02
R5599:Spef2 UTSW 15 9729703 missense possibly damaging 0.53
R5605:Spef2 UTSW 15 9609520 missense probably damaging 0.96
R5787:Spef2 UTSW 15 9748726 missense possibly damaging 0.91
R5939:Spef2 UTSW 15 9614215 missense probably benign 0.16
R6177:Spef2 UTSW 15 9727532 missense possibly damaging 0.89
R6641:Spef2 UTSW 15 9625973 missense probably damaging 1.00
R6665:Spef2 UTSW 15 9600518 critical splice donor site probably null
R6944:Spef2 UTSW 15 9592749 missense probably damaging 1.00
R6956:Spef2 UTSW 15 9684935 missense probably damaging 1.00
R6968:Spef2 UTSW 15 9597340 missense probably benign 0.02
R7089:Spef2 UTSW 15 9725171 missense probably damaging 1.00
R7117:Spef2 UTSW 15 9729838 missense probably damaging 1.00
R7161:Spef2 UTSW 15 9717603 missense probably benign 0.29
R7223:Spef2 UTSW 15 9601640 missense unknown
R7270:Spef2 UTSW 15 9599980 critical splice donor site probably null
R7303:Spef2 UTSW 15 9647490 missense possibly damaging 0.92
R7369:Spef2 UTSW 15 9584207 missense probably benign 0.02
R7464:Spef2 UTSW 15 9740585 missense probably benign 0.23
R7498:Spef2 UTSW 15 9727539 missense probably benign
R7587:Spef2 UTSW 15 9713219 missense probably damaging 1.00
R7748:Spef2 UTSW 15 9652945 missense probably damaging 0.98
R7772:Spef2 UTSW 15 9704481 missense probably damaging 0.99
X0025:Spef2 UTSW 15 9596622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTAATCCTGGCACCAGAATG -3'
(R):5'- ACAGCAAACAAGGCATTTTGTC -3'

Sequencing Primer
(F):5'- CCTGGCACCAGAATGATTTTTAGG -3'
(R):5'- TTAGTTGCCTGGAGAAGTTAAAAG -3'
Posted On2019-10-16