Incidental Mutation 'R7263:Slf2'
ID 580631
Institutional Source Beutler Lab
Gene Symbol Slf2
Ensembl Gene ENSMUSG00000036097
Gene Name SMC5-SMC6 complex localization factor 2
Synonyms Fam178a, 6030443O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock # R7263 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 44931119-44983787 bp(+) (GRCm38)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 44938424 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096053]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000096053
SMART Domains Protein: ENSMUSP00000093758
Gene: ENSMUSG00000036097

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 91 103 N/A INTRINSIC
low complexity region 211 226 N/A INTRINSIC
coiled coil region 239 266 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 549 568 N/A INTRINSIC
low complexity region 572 582 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
Pfam:FAM178 647 1021 3.9e-146 PFAM
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 122,054,194 H55N probably damaging Het
Acan G T 7: 79,092,318 V488L probably damaging Het
Adam12 T C 7: 133,919,511 E638G possibly damaging Het
Adamts20 T A 15: 94,322,891 Q1387L possibly damaging Het
Adamts3 G T 5: 89,677,742 D1079E probably benign Het
Barx1 G T 13: 48,665,079 G93C probably damaging Het
Carmil2 C T 8: 105,693,045 R828C probably damaging Het
Catsper4 TTCTC TTC 4: 134,227,112 probably null Het
Ccdc159 T C 9: 21,931,711 M148T probably benign Het
Cdk5rap1 T A 2: 154,360,732 N193Y probably benign Het
Csnk1g2 G A 10: 80,634,498 G15D probably damaging Het
Dach1 T C 14: 98,168,859 S151G probably benign Het
Elf5 C A 2: 103,439,300 N75K probably benign Het
Elp3 T C 14: 65,565,333 D272G probably damaging Het
Epb41l1 T A 2: 156,495,123 probably null Het
Epha6 A G 16: 59,775,665 Y888H probably damaging Het
Fibcd1 T C 2: 31,817,210 Y345C probably damaging Het
Gjc1 C T 11: 102,800,137 E347K possibly damaging Het
Gm16486 A G 8: 70,710,776 N873D possibly damaging Het
Gse1 A G 8: 120,574,171 D892G unknown Het
Gtpbp6 A T 5: 110,104,049 I506N probably benign Het
Hivep1 T A 13: 42,158,192 F1303I possibly damaging Het
Il21r A G 7: 125,632,905 T502A probably benign Het
Ints1 T C 5: 139,764,079 T997A possibly damaging Het
Invs C A 4: 48,396,381 N351K probably damaging Het
Iqcm A G 8: 75,763,073 T390A probably benign Het
Kcnh4 C T 11: 100,741,817 G948D probably benign Het
Kcnh7 T A 2: 62,735,970 probably null Het
Lrrc72 A G 12: 36,208,612 V82A probably damaging Het
Macf1 A T 4: 123,378,150 L6535Q probably damaging Het
Ncor2 G C 5: 125,032,132 L585V Het
Nipal2 G C 15: 34,578,758 Y298* probably null Het
Nipsnap1 C T 11: 4,882,960 probably benign Het
Olfr1112 T A 2: 87,192,132 C148* probably null Het
Olfr1267-ps1 T C 2: 90,085,988 I158V not run Het
Olfr578 A T 7: 102,984,317 Y282* probably null Het
Pcdhga4 C T 18: 37,686,820 T474I probably benign Het
Pdp1 G T 4: 11,960,821 Q516K possibly damaging Het
Pik3c2b C T 1: 133,090,202 P934L probably damaging Het
Pp2d1 A G 17: 53,515,330 I236T probably benign Het
Pygm G A 19: 6,388,327 R278H probably damaging Het
Rb1 A T 14: 73,282,923 C215* probably null Het
Rgs22 A G 15: 36,015,643 S1156P possibly damaging Het
Rgs9bp T C 7: 35,584,701 T174A probably damaging Het
Rnf133 A T 6: 23,649,668 Y130* probably null Het
Sctr G A 1: 120,022,225 R48Q probably benign Het
Serpinb6e A T 13: 33,838,940 F153L probably benign Het
Slc22a1 A T 17: 12,666,700 Y200N probably damaging Het
Slc22a22 C A 15: 57,249,711 M377I probably benign Het
Slc36a4 A G 9: 15,722,156 probably null Het
Slc39a6 A G 18: 24,601,203 V143A probably benign Het
Sowaha T C 11: 53,479,658 K84E probably benign Het
Spef2 T G 15: 9,653,012 probably null Het
Sphkap A T 1: 83,276,678 F1117I probably damaging Het
Tas2r113 T C 6: 132,893,576 I189T possibly damaging Het
Tescl T C 7: 24,333,822 E26G possibly damaging Het
Trpm6 A T 19: 18,876,786 I1847F probably damaging Het
Uba1y T A Y: 822,200 C178S possibly damaging Het
Ush2a T A 1: 188,443,329 V1208D possibly damaging Het
Usp13 G C 3: 32,894,851 A446P probably damaging Het
Usp7 A T 16: 8,696,724 C722S possibly damaging Het
Vmn1r52 A G 6: 90,179,553 S280G probably benign Het
Vmn2r84 T C 10: 130,389,208 K478E probably damaging Het
Zfp112 C A 7: 24,125,527 L311I probably benign Het
Zfp180 G T 7: 24,105,700 E515* probably null Het
Zfp518b A G 5: 38,672,328 I778T probably damaging Het
Zfp800 A T 6: 28,243,663 H434Q probably benign Het
Other mutations in Slf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Slf2 APN 19 44973267 critical splice donor site probably null
IGL01904:Slf2 APN 19 44949141 critical splice donor site probably null
IGL02429:Slf2 APN 19 44941728 missense probably benign
IGL02899:Slf2 APN 19 44942020 missense probably benign 0.26
Evidentiary UTSW 19 44938424 splice site probably null
BB004:Slf2 UTSW 19 44935301 missense probably damaging 0.97
BB014:Slf2 UTSW 19 44935301 missense probably damaging 0.97
R0060:Slf2 UTSW 19 44948004 missense probably damaging 1.00
R0731:Slf2 UTSW 19 44975726 splice site probably benign
R1158:Slf2 UTSW 19 44931416 missense probably damaging 0.99
R1590:Slf2 UTSW 19 44942073 nonsense probably null
R1608:Slf2 UTSW 19 44949001 missense probably benign 0.08
R1823:Slf2 UTSW 19 44935248 missense possibly damaging 0.86
R2511:Slf2 UTSW 19 44941606 missense possibly damaging 0.86
R3040:Slf2 UTSW 19 44980569 missense probably damaging 0.99
R3236:Slf2 UTSW 19 44942334 missense probably benign 0.33
R3237:Slf2 UTSW 19 44942334 missense probably benign 0.33
R3552:Slf2 UTSW 19 44934951 nonsense probably null
R3754:Slf2 UTSW 19 44973237 missense probably benign
R4683:Slf2 UTSW 19 44935481 missense probably benign 0.22
R4757:Slf2 UTSW 19 44935058 missense probably benign
R4782:Slf2 UTSW 19 44934925 splice site probably null
R4914:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4915:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4916:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4917:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4918:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R5069:Slf2 UTSW 19 44935253 missense possibly damaging 0.94
R5092:Slf2 UTSW 19 44952084 missense probably benign 0.14
R5215:Slf2 UTSW 19 44948037 missense probably damaging 0.99
R5276:Slf2 UTSW 19 44935161 missense possibly damaging 0.84
R5656:Slf2 UTSW 19 44973235 missense probably benign 0.13
R6132:Slf2 UTSW 19 44960861 missense possibly damaging 0.60
R6358:Slf2 UTSW 19 44935425 missense probably benign 0.34
R6481:Slf2 UTSW 19 44973164 missense probably benign 0.01
R6809:Slf2 UTSW 19 44943468 missense probably damaging 0.98
R7912:Slf2 UTSW 19 44942243 missense probably damaging 0.96
R7914:Slf2 UTSW 19 44959060 missense possibly damaging 0.71
R7927:Slf2 UTSW 19 44935301 missense probably damaging 0.97
R8006:Slf2 UTSW 19 44942317 missense probably damaging 0.99
R8154:Slf2 UTSW 19 44935157 missense possibly damaging 0.94
R8746:Slf2 UTSW 19 44973624 missense probably damaging 1.00
R9075:Slf2 UTSW 19 44942421 missense probably damaging 0.99
R9352:Slf2 UTSW 19 44943518 missense probably null 0.97
R9354:Slf2 UTSW 19 44948032 missense probably damaging 0.98
R9369:Slf2 UTSW 19 44935514 nonsense probably null
R9412:Slf2 UTSW 19 44942021 missense probably benign 0.31
R9743:Slf2 UTSW 19 44942133 missense probably benign 0.40
R9778:Slf2 UTSW 19 44973227 missense probably benign 0.04
Z1176:Slf2 UTSW 19 44941665 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGTTATATCTCCAGCCCATACTC -3'
(R):5'- AGACATTTACTTCTAGGAAGGGAACTG -3'

Sequencing Primer
(F):5'- CAGCCCATACTCTTCATTTTAAGAAC -3'
(R):5'- GATTTCTGAGTTCCAGGCCAGC -3'
Posted On 2019-10-16