Incidental Mutation 'R0633:Sumf1'
ID58065
Institutional Source Beutler Lab
Gene Symbol Sumf1
Ensembl Gene ENSMUSG00000030101
Gene Namesulfatase modifying factor 1
Synonyms
MMRRC Submission 038822-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R0633 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location108107028-108185582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108144671 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 158 (Y158D)
Ref Sequence ENSEMBL: ENSMUSP00000132321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032191] [ENSMUST00000167338] [ENSMUST00000169446] [ENSMUST00000172188]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000025040
Predicted Effect probably damaging
Transcript: ENSMUST00000032191
AA Change: Y290D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032191
Gene: ENSMUSG00000030101
AA Change: Y290D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
Pfam:FGE-sulfatase 85 365 1.4e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167338
AA Change: Y265D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127537
Gene: ENSMUSG00000030101
AA Change: Y265D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
Pfam:FGE-sulfatase 85 340 1.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169446
AA Change: Y9D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130061
Gene: ENSMUSG00000030101
AA Change: Y9D

DomainStartEndE-ValueType
Pfam:FGE-sulfatase 1 83 6.6e-18 PFAM
low complexity region 139 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171697
Predicted Effect probably damaging
Transcript: ENSMUST00000172188
AA Change: Y158D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132321
Gene: ENSMUSG00000030101
AA Change: Y158D

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
Pfam:FGE-sulfatase 85 149 9.5e-18 PFAM
Pfam:FGE-sulfatase 144 233 4.9e-30 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the hydrolysis of sulfate esters by oxidizing a cysteine residue in the substrate sulfatase to an active site 3-oxoalanine residue, which is also known as C-alpha-formylglycine. Mutations in this gene cause multiple sulfatase deficiency, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes lacking all sulfatase activities exhibit frequent early postnatal lethality and growth retardation, skeletal anomalies, neurological defects, and massive GAG accumulation and cell vacuolization in all tissues in association with systemic inflammation, apoptosis, and neurodegeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,325,701 I82L probably benign Het
4921530L21Rik T G 14: 95,881,943 N45K probably damaging Het
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Adamts8 A T 9: 30,943,511 R18S probably damaging Het
Adgb G A 10: 10,391,729 A923V probably benign Het
Aldh1a3 A G 7: 66,400,222 V416A probably damaging Het
Alox5 C T 6: 116,420,384 G280R probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Apbb1 C T 7: 105,558,963 V685I probably damaging Het
Apc2 C A 10: 80,307,455 A463E probably damaging Het
Arhgap21 C T 2: 20,855,387 W1170* probably null Het
Atat1 G A 17: 35,901,423 R305C probably damaging Het
Cars2 T C 8: 11,550,511 D56G probably benign Het
Cdc42bpb T C 12: 111,345,555 I108V probably damaging Het
Cftr T A 6: 18,305,980 I1255K probably damaging Het
Ckap5 T C 2: 91,550,743 L148P probably damaging Het
Cntn4 A G 6: 106,679,248 probably null Het
Cpe G A 8: 64,609,203 P273L probably damaging Het
Cpsf7 A G 19: 10,531,782 D19G probably benign Het
Ddx25 C A 9: 35,545,972 R349L probably damaging Het
Depdc7 T C 2: 104,722,881 D446G probably benign Het
Det1 T A 7: 78,843,935 N107I probably benign Het
Dock6 A T 9: 21,844,417 D170E probably benign Het
Dvl1 C T 4: 155,858,295 L673F probably damaging Het
Gucy1b1 A T 3: 82,045,460 I222K probably benign Het
Hfm1 T C 5: 106,917,601 T71A possibly damaging Het
Ikzf1 A G 11: 11,769,223 E310G probably damaging Het
Impg1 T C 9: 80,394,155 E163G possibly damaging Het
Itpr2 G T 6: 146,374,456 H426Q probably damaging Het
Itpripl2 C T 7: 118,490,256 G360D probably benign Het
Kif14 C T 1: 136,527,305 R1572C probably damaging Het
L3mbtl3 A T 10: 26,302,685 H568Q unknown Het
Lgi2 A G 5: 52,554,460 Y173H probably damaging Het
Lpar5 A C 6: 125,081,991 Y225S probably benign Het
Lpin3 A G 2: 160,903,974 H675R probably damaging Het
Lrp2 C A 2: 69,448,120 G3963V probably damaging Het
Man1a2 G T 3: 100,684,575 D13E possibly damaging Het
Map1a T C 2: 121,308,014 V2753A probably damaging Het
Mitf C A 6: 98,003,904 N97K probably damaging Het
Msh2 A G 17: 87,672,810 probably null Het
Msr1 T C 8: 39,620,000 E170G probably damaging Het
Myrip C A 9: 120,388,236 R79S probably damaging Het
Nek10 G A 14: 14,857,782 probably null Het
Neto1 C T 18: 86,404,729 R104* probably null Het
Nom1 A C 5: 29,451,100 K821T probably damaging Het
Nrxn1 A G 17: 90,704,181 V340A probably damaging Het
Nxpe4 A T 9: 48,396,597 I334F probably benign Het
Olfr1043 T A 2: 86,162,091 N286I probably damaging Het
Olfr1065 C T 2: 86,445,129 M284I probably benign Het
Olfr1247 T C 2: 89,609,374 M243V probably benign Het
Olfr1489 T C 19: 13,633,336 V75A probably damaging Het
Olfr382 A G 11: 73,516,927 S91P probably benign Het
Olfr705 T C 7: 106,713,977 K235E probably benign Het
Padi4 A G 4: 140,757,585 S322P probably damaging Het
Peli3 A G 19: 4,941,782 Y44H probably damaging Het
Prdm4 A G 10: 85,907,903 S163P probably damaging Het
Prom2 T C 2: 127,539,525 D227G probably benign Het
Ptgfr C T 3: 151,801,763 R321H probably benign Het
Rgs3 G A 4: 62,625,906 R136H probably damaging Het
Rgsl1 T G 1: 153,844,107 N3T possibly damaging Het
Rif1 T C 2: 52,112,563 S2010P probably benign Het
Rngtt T C 4: 33,368,690 F408L probably damaging Het
Rtn3 T G 19: 7,457,593 T326P probably benign Het
Slc18b1 A C 10: 23,806,038 M167L probably benign Het
Slc22a26 A G 19: 7,788,210 probably null Het
Slitrk6 T C 14: 110,751,885 D130G probably damaging Het
Snap47 A G 11: 59,428,613 V233A probably benign Het
Tbc1d15 A T 10: 115,220,310 H252Q probably benign Het
Thsd7b T C 1: 130,188,526 S1339P possibly damaging Het
Tmem45a2 T C 16: 57,049,414 I56V probably benign Het
Ttc21b A G 2: 66,236,233 S359P probably benign Het
Ttc27 T C 17: 74,729,977 I215T probably benign Het
Ttn C T 2: 76,724,195 V30759I possibly damaging Het
Vdac3 T C 8: 22,580,388 N168S probably damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Wrap73 T A 4: 154,142,491 F16Y probably damaging Het
Zfat C A 15: 68,180,803 D381Y probably damaging Het
Other mutations in Sumf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Sumf1 APN 6 108176016 missense probably damaging 1.00
IGL01624:Sumf1 APN 6 108153201 missense probably damaging 1.00
IGL02146:Sumf1 APN 6 108173431 critical splice acceptor site probably null
R0594:Sumf1 UTSW 6 108173414 missense probably benign 0.31
R1479:Sumf1 UTSW 6 108176058 missense probably damaging 1.00
R3036:Sumf1 UTSW 6 108153191 missense possibly damaging 0.92
R3054:Sumf1 UTSW 6 108153204 missense probably benign 0.14
R4246:Sumf1 UTSW 6 108155013 missense probably damaging 1.00
R4247:Sumf1 UTSW 6 108155013 missense probably damaging 1.00
R4249:Sumf1 UTSW 6 108155013 missense probably damaging 1.00
R4574:Sumf1 UTSW 6 108108432 unclassified probably benign
R4853:Sumf1 UTSW 6 108185495 missense probably benign 0.00
R5146:Sumf1 UTSW 6 108185310 missense probably benign 0.12
R5764:Sumf1 UTSW 6 108118463 intron probably benign
R7981:Sumf1 UTSW 6 108152225 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAACCCTTGCTGCTGTCTGCTCAG -3'
(R):5'- GCACGCACGTATTCTTACACGCAC -3'

Sequencing Primer
(F):5'- CTGTCTGCTCAGAGGACAAG -3'
(R):5'- GTCAAGCCTTGGTACTTATAGTTAG -3'
Posted On2013-07-11