Incidental Mutation 'R7490:Aqr'
ID580654
Institutional Source Beutler Lab
Gene Symbol Aqr
Ensembl Gene ENSMUSG00000040383
Gene Nameaquarius
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7490 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location114101170-114187024 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 114158868 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]
Predicted Effect probably null
Transcript: ENSMUST00000043160
SMART Domains Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383

DomainStartEndE-ValueType
Pfam:Aquarius_N 18 802 N/A PFAM
Pfam:ResIII 797 911 8.2e-7 PFAM
Pfam:AAA_11 801 1111 9.6e-32 PFAM
Pfam:AAA_19 807 894 3.7e-11 PFAM
Pfam:AAA_12 1119 1312 2.1e-27 PFAM
low complexity region 1394 1417 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102543
SMART Domains Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 762 776 N/A INTRINSIC
Pfam:AAA_11 801 1111 3.2e-32 PFAM
Pfam:AAA_19 807 893 6.5e-11 PFAM
Pfam:AAA_12 1119 1312 2.6e-27 PFAM
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,163,230 D132G possibly damaging Het
Abca5 T C 11: 110,277,611 E1424G possibly damaging Het
Adamts4 C T 1: 171,256,600 Q549* probably null Het
Adcy4 A G 14: 55,770,433 I893T possibly damaging Het
Ago1 A T 4: 126,439,505 *858R probably null Het
Ank2 T A 3: 126,958,889 I393L probably damaging Het
Ankrd44 T C 1: 54,648,300 T987A probably benign Het
Ap2a1 G T 7: 44,902,789 N790K probably benign Het
Arel1 G T 12: 84,941,911 F21L probably damaging Het
Atp1a3 T C 7: 24,987,470 D743G probably damaging Het
Atp9a A T 2: 168,675,352 F354I probably benign Het
Bag6 A G 17: 35,140,842 H259R unknown Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCTGTG GTCACTGGTTCTGTGTTCACTGGTTCTGTG 3: 95,888,166 probably benign Het
BC028528 TGGTT TGGTTCTGTGGTCACGGGTT 3: 95,888,186 probably benign Het
Bckdk T A 7: 127,904,973 S15T unknown Het
C4b G T 17: 34,731,080 Y1405* probably null Het
Camk4 G A 18: 32,939,545 probably null Het
Car11 T A 7: 45,700,318 W16R probably benign Het
Ccdc80 A C 16: 45,096,400 E506D probably damaging Het
Chmp6 C T 11: 119,915,443 Q32* probably null Het
Colq G A 14: 31,545,086 P166S possibly damaging Het
Ctxn3 T C 18: 57,477,285 M58T probably damaging Het
Cxcl3 A T 5: 90,786,657 I93L unknown Het
Dnaaf2 T C 12: 69,197,606 Y227C probably damaging Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dnmt3a G A 12: 3,904,204 G792D probably damaging Het
Dsg4 T A 18: 20,451,936 probably null Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Fbxl13 T A 5: 21,523,060 R550* probably null Het
Gm4302 A T 10: 100,341,583 Q243L unknown Het
Gm7168 A T 17: 13,949,013 Y214F probably benign Het
Gtf3c1 C T 7: 125,647,491 D1549N probably damaging Het
Gtf3c5 A T 2: 28,571,141 D320E probably damaging Het
Hivep1 T A 13: 42,157,650 V1122D probably damaging Het
Ibtk T C 9: 85,718,934 probably null Het
Irs1 T A 1: 82,287,264 Q1077L probably damaging Het
Ivd A T 2: 118,876,892 M296L possibly damaging Het
Katnal1 T C 5: 148,891,682 D318G probably null Het
L3mbtl3 C T 10: 26,339,231 V194I unknown Het
Malt1 C A 18: 65,448,211 Q237K probably benign Het
March11 C T 15: 26,311,101 A221V possibly damaging Het
Mgea5 G A 19: 45,767,447 R586* probably null Het
Nfe2l3 A G 6: 51,457,544 I361M possibly damaging Het
Nrg1 G A 8: 31,818,654 R493C probably damaging Het
Olfr1019 A T 2: 85,840,963 V276E probably damaging Het
Olfr1212 A C 2: 88,959,048 Y194S probably benign Het
Olfr453 T C 6: 42,744,805 I256T probably damaging Het
Olfr577 G A 7: 102,973,810 P61S probably damaging Het
Olfr828 A T 9: 18,815,933 Y120* probably null Het
Olfr980 T A 9: 40,006,424 H175L probably damaging Het
Orai3 C T 7: 127,773,627 A100V possibly damaging Het
Oxsm T A 14: 16,241,066 M328L probably benign Het
Pan2 T C 10: 128,308,440 V186A probably benign Het
Pkd1l1 T A 11: 8,916,265 D980V Het
Ppp1r16b T C 2: 158,761,468 Y438H probably damaging Het
Ppp4c A T 7: 126,787,332 H164Q probably damaging Het
Prl8a2 C A 13: 27,352,770 T125K possibly damaging Het
Rasa2 T C 9: 96,566,122 N494S possibly damaging Het
Rpl18a T C 8: 70,895,506 D147G probably benign Het
Scg3 T C 9: 75,669,277 D272G possibly damaging Het
Serpinb6c T A 13: 33,893,835 D184V probably benign Het
Simc1 T G 13: 54,524,349 L170R possibly damaging Het
Slx4 T C 16: 3,980,131 E1463G possibly damaging Het
Stk31 T A 6: 49,439,232 probably null Het
Tas1r3 A G 4: 155,862,023 I375T probably damaging Het
Tbc1d24 T C 17: 24,182,520 D405G probably damaging Het
Tcerg1l G A 7: 138,259,828 P391S probably damaging Het
Tiam1 T C 16: 89,898,195 S125G probably benign Het
Trim16 C A 11: 62,834,123 H246N probably damaging Het
Tti1 T A 2: 157,995,472 N896I probably damaging Het
Ubash3a A G 17: 31,232,312 N395S probably damaging Het
Uggt1 T C 1: 36,164,508 I1014V probably benign Het
Vmn1r30 T A 6: 58,435,229 Q206L possibly damaging Het
Washc5 T A 15: 59,337,204 N1057I probably benign Het
Xpo4 GGTATTAGCGGAGT GGT 14: 57,602,621 probably null Het
Zcchc14 A T 8: 121,605,017 S536T unknown Het
Other mutations in Aqr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Aqr APN 2 114125942 missense possibly damaging 0.90
IGL00694:Aqr APN 2 114151525 missense probably damaging 1.00
IGL02113:Aqr APN 2 114120027 nonsense probably null
IGL02297:Aqr APN 2 114150481 missense probably benign 0.24
IGL02380:Aqr APN 2 114109936 missense probably damaging 1.00
IGL02410:Aqr APN 2 114136917 missense possibly damaging 0.85
IGL02413:Aqr APN 2 114118780 missense possibly damaging 0.87
IGL02474:Aqr APN 2 114112646 missense probably damaging 1.00
IGL02941:Aqr APN 2 114113354 missense probably damaging 1.00
IGL02981:Aqr APN 2 114134824 splice site probably benign
IGL03001:Aqr APN 2 114146919 missense probably benign
IGL03092:Aqr APN 2 114158943 missense probably benign 0.38
IGL03222:Aqr APN 2 114121256 missense probably damaging 1.00
capricorn UTSW 2 114105882 missense probably damaging 1.00
Goat UTSW 2 114157575 missense probably damaging 1.00
Pliades UTSW 2 114132976 missense probably damaging 1.00
sagittarius UTSW 2 114149016 missense probably damaging 1.00
Zodiac UTSW 2 114108109 missense probably damaging 0.96
PIT4531001:Aqr UTSW 2 114130734 missense possibly damaging 0.94
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0152:Aqr UTSW 2 114159010 missense probably benign 0.07
R0352:Aqr UTSW 2 114170052 missense probably damaging 1.00
R0371:Aqr UTSW 2 114157604 missense possibly damaging 0.80
R0374:Aqr UTSW 2 114130611 missense probably damaging 1.00
R0550:Aqr UTSW 2 114132976 missense probably damaging 1.00
R0604:Aqr UTSW 2 114130604 missense probably benign 0.00
R0685:Aqr UTSW 2 114140977 missense probably damaging 1.00
R1236:Aqr UTSW 2 114116655 missense probably damaging 1.00
R1434:Aqr UTSW 2 114150409 missense probably damaging 1.00
R1806:Aqr UTSW 2 114161652 missense probably damaging 1.00
R2154:Aqr UTSW 2 114137004 missense probably damaging 1.00
R2185:Aqr UTSW 2 114130534 critical splice donor site probably null
R2377:Aqr UTSW 2 114140940 missense possibly damaging 0.58
R2862:Aqr UTSW 2 114136917 missense probably damaging 1.00
R3615:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3616:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3713:Aqr UTSW 2 114118669 splice site probably benign
R3715:Aqr UTSW 2 114118669 splice site probably benign
R4586:Aqr UTSW 2 114112577 missense probably benign 0.06
R4663:Aqr UTSW 2 114161666 nonsense probably null
R4809:Aqr UTSW 2 114175214 utr 5 prime probably benign
R4887:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4888:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4952:Aqr UTSW 2 114109937 missense probably damaging 1.00
R4974:Aqr UTSW 2 114113351 missense probably damaging 1.00
R5050:Aqr UTSW 2 114112609 nonsense probably null
R5050:Aqr UTSW 2 114170025 critical splice donor site probably null
R5213:Aqr UTSW 2 114113327 missense probably damaging 1.00
R5263:Aqr UTSW 2 114116578 missense probably damaging 1.00
R5470:Aqr UTSW 2 114157575 missense probably damaging 1.00
R5488:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5489:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5567:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5570:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5641:Aqr UTSW 2 114149034 missense probably damaging 1.00
R5685:Aqr UTSW 2 114156265 missense possibly damaging 0.87
R5963:Aqr UTSW 2 114126961 missense probably damaging 1.00
R5992:Aqr UTSW 2 114143049 nonsense probably null
R6015:Aqr UTSW 2 114175165 start codon destroyed probably null 0.53
R6253:Aqr UTSW 2 114156277 missense possibly damaging 0.93
R6264:Aqr UTSW 2 114109964 missense probably damaging 1.00
R6773:Aqr UTSW 2 114148996 missense possibly damaging 0.64
R6877:Aqr UTSW 2 114116571 nonsense probably null
R7211:Aqr UTSW 2 114134723 missense probably benign 0.01
R7232:Aqr UTSW 2 114105882 missense probably damaging 1.00
R7308:Aqr UTSW 2 114104062 missense possibly damaging 0.86
R7396:Aqr UTSW 2 114119946 nonsense probably null
R7526:Aqr UTSW 2 114108109 missense probably damaging 0.96
R7629:Aqr UTSW 2 114114593 missense probably damaging 1.00
R7828:Aqr UTSW 2 114149016 missense probably damaging 1.00
R8037:Aqr UTSW 2 114161680 missense probably damaging 1.00
R8166:Aqr UTSW 2 114113325 missense possibly damaging 0.95
R8712:Aqr UTSW 2 114118877 missense probably damaging 1.00
Z1176:Aqr UTSW 2 114108122 missense probably damaging 0.98
Z1176:Aqr UTSW 2 114109991 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GAGGAGGAATCAAGTCCAAACTTC -3'
(R):5'- CAGTGATGAGAGGTCTGCAG -3'

Sequencing Primer
(F):5'- GGAATCAAGTCCAAACTTCTAAAGG -3'
(R):5'- TGAAAGCGGCCTTAGCT -3'
Posted On2019-10-17