Incidental Mutation 'R7490:Car11'
ID580674
Institutional Source Beutler Lab
Gene Symbol Car11
Ensembl Gene ENSMUSG00000003273
Gene Namecarbonic anhydrase 11
SynonymsCA-RP XI
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7490 (G1)
Quality Score139.008
Status Not validated
Chromosome7
Chromosomal Location45699843-45704682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45700318 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 16 (W16R)
Ref Sequence ENSEMBL: ENSMUSP00000003360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003360] [ENSMUST00000080885] [ENSMUST00000211357] [ENSMUST00000211513]
Predicted Effect probably benign
Transcript: ENSMUST00000003360
AA Change: W16R

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000003360
Gene: ENSMUSG00000003273
AA Change: W16R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Carb_anhydrase 35 303 1.1e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080885
SMART Domains Protein: ENSMUSP00000079693
Gene: ENSMUSG00000059824

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
low complexity region 71 98 N/A INTRINSIC
low complexity region 127 171 N/A INTRINSIC
BRLZ 253 317 5.17e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209796
Predicted Effect probably benign
Transcript: ENSMUST00000210027
Predicted Effect probably benign
Transcript: ENSMUST00000211357
Predicted Effect probably benign
Transcript: ENSMUST00000211513
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA XI is likely a secreted protein, however, radical changes at active site residues completely conserved in CA isozymes with catalytic activity, make it unlikely that it has carbonic anhydrase activity. It shares properties in common with two other acatalytic CA isoforms, CA VIII and CA X. CA XI is most abundantly expressed in brain, and may play a general role in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,163,230 D132G possibly damaging Het
Abca5 T C 11: 110,277,611 E1424G possibly damaging Het
Adamts4 C T 1: 171,256,600 Q549* probably null Het
Adcy4 A G 14: 55,770,433 I893T possibly damaging Het
Ago1 A T 4: 126,439,505 *858R probably null Het
Ank2 T A 3: 126,958,889 I393L probably damaging Het
Ankrd44 T C 1: 54,648,300 T987A probably benign Het
Ap2a1 G T 7: 44,902,789 N790K probably benign Het
Aqr A G 2: 114,158,868 probably null Het
Arel1 G T 12: 84,941,911 F21L probably damaging Het
Atp1a3 T C 7: 24,987,470 D743G probably damaging Het
Atp9a A T 2: 168,675,352 F354I probably benign Het
Bag6 A G 17: 35,140,842 H259R unknown Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCTGTG GTCACTGGTTCTGTGTTCACTGGTTCTGTG 3: 95,888,166 probably benign Het
BC028528 TGGTT TGGTTCTGTGGTCACGGGTT 3: 95,888,186 probably benign Het
Bckdk T A 7: 127,904,973 S15T unknown Het
C4b G T 17: 34,731,080 Y1405* probably null Het
Camk4 G A 18: 32,939,545 probably null Het
Ccdc80 A C 16: 45,096,400 E506D probably damaging Het
Chmp6 C T 11: 119,915,443 Q32* probably null Het
Colq G A 14: 31,545,086 P166S possibly damaging Het
Ctxn3 T C 18: 57,477,285 M58T probably damaging Het
Cxcl3 A T 5: 90,786,657 I93L unknown Het
Dnaaf2 T C 12: 69,197,606 Y227C probably damaging Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dnmt3a G A 12: 3,904,204 G792D probably damaging Het
Dsg4 T A 18: 20,451,936 probably null Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Fbxl13 T A 5: 21,523,060 R550* probably null Het
Gm4302 A T 10: 100,341,583 Q243L unknown Het
Gm7168 A T 17: 13,949,013 Y214F probably benign Het
Gtf3c1 C T 7: 125,647,491 D1549N probably damaging Het
Gtf3c5 A T 2: 28,571,141 D320E probably damaging Het
Hivep1 T A 13: 42,157,650 V1122D probably damaging Het
Ibtk T C 9: 85,718,934 probably null Het
Irs1 T A 1: 82,287,264 Q1077L probably damaging Het
Ivd A T 2: 118,876,892 M296L possibly damaging Het
Katnal1 T C 5: 148,891,682 D318G probably null Het
L3mbtl3 C T 10: 26,339,231 V194I unknown Het
Malt1 C A 18: 65,448,211 Q237K probably benign Het
March11 C T 15: 26,311,101 A221V possibly damaging Het
Mgea5 G A 19: 45,767,447 R586* probably null Het
Nfe2l3 A G 6: 51,457,544 I361M possibly damaging Het
Nrg1 G A 8: 31,818,654 R493C probably damaging Het
Olfr1019 A T 2: 85,840,963 V276E probably damaging Het
Olfr1212 A C 2: 88,959,048 Y194S probably benign Het
Olfr453 T C 6: 42,744,805 I256T probably damaging Het
Olfr577 G A 7: 102,973,810 P61S probably damaging Het
Olfr828 A T 9: 18,815,933 Y120* probably null Het
Olfr980 T A 9: 40,006,424 H175L probably damaging Het
Orai3 C T 7: 127,773,627 A100V possibly damaging Het
Oxsm T A 14: 16,241,066 M328L probably benign Het
Pan2 T C 10: 128,308,440 V186A probably benign Het
Pkd1l1 T A 11: 8,916,265 D980V Het
Ppp1r16b T C 2: 158,761,468 Y438H probably damaging Het
Ppp4c A T 7: 126,787,332 H164Q probably damaging Het
Prl8a2 C A 13: 27,352,770 T125K possibly damaging Het
Rasa2 T C 9: 96,566,122 N494S possibly damaging Het
Rpl18a T C 8: 70,895,506 D147G probably benign Het
Scg3 T C 9: 75,669,277 D272G possibly damaging Het
Serpinb6c T A 13: 33,893,835 D184V probably benign Het
Simc1 T G 13: 54,524,349 L170R possibly damaging Het
Slx4 T C 16: 3,980,131 E1463G possibly damaging Het
Stk31 T A 6: 49,439,232 probably null Het
Tas1r3 A G 4: 155,862,023 I375T probably damaging Het
Tbc1d24 T C 17: 24,182,520 D405G probably damaging Het
Tcerg1l G A 7: 138,259,828 P391S probably damaging Het
Tiam1 T C 16: 89,898,195 S125G probably benign Het
Trim16 C A 11: 62,834,123 H246N probably damaging Het
Tti1 T A 2: 157,995,472 N896I probably damaging Het
Ubash3a A G 17: 31,232,312 N395S probably damaging Het
Uggt1 T C 1: 36,164,508 I1014V probably benign Het
Vmn1r30 T A 6: 58,435,229 Q206L possibly damaging Het
Washc5 T A 15: 59,337,204 N1057I probably benign Het
Xpo4 GGTATTAGCGGAGT GGT 14: 57,602,621 probably null Het
Zcchc14 A T 8: 121,605,017 S536T unknown Het
Other mutations in Car11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02195:Car11 APN 7 45701292 missense probably damaging 0.97
IGL03189:Car11 APN 7 45702455 missense probably damaging 0.98
R1201:Car11 UTSW 7 45703480 missense probably benign
R1625:Car11 UTSW 7 45701307 missense probably benign 0.04
R1670:Car11 UTSW 7 45703525 missense possibly damaging 0.52
R2430:Car11 UTSW 7 45703648 intron probably null
R2509:Car11 UTSW 7 45701359 missense probably damaging 0.96
R2510:Car11 UTSW 7 45701359 missense probably damaging 0.96
R2680:Car11 UTSW 7 45702485 missense probably benign
R3926:Car11 UTSW 7 45700491 missense probably benign 0.17
R5511:Car11 UTSW 7 45700461 missense probably damaging 1.00
R5639:Car11 UTSW 7 45702621 critical splice donor site probably null
R7395:Car11 UTSW 7 45701321 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACATCAAACCAGTGGGAGC -3'
(R):5'- CGAAGTTTCCCTGGAGATTCTC -3'

Sequencing Primer
(F):5'- TCAAACGGGCTCTGGGGTAC -3'
(R):5'- GAGATTCTCCTTGTAGCTCCACCAG -3'
Posted On2019-10-17