Incidental Mutation 'R7490:Orai3'
Institutional Source Beutler Lab
Gene Symbol Orai3
Ensembl Gene ENSMUSG00000043964
Gene NameORAI calcium release-activated calcium modulator 3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R7490 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location127769815-127775150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127773627 bp
Amino Acid Change Alanine to Valine at position 100 (A100V)
Ref Sequence ENSEMBL: ENSMUSP00000050279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033081] [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000061587] [ENSMUST00000118865] [ENSMUST00000121504] [ENSMUST00000126761] [ENSMUST00000143951] [ENSMUST00000144406] [ENSMUST00000186116] [ENSMUST00000186207] [ENSMUST00000188580] [ENSMUST00000206893]
Predicted Effect probably benign
Transcript: ENSMUST00000033081
SMART Domains Protein: ENSMUSP00000033081
Gene: ENSMUSG00000030811

Pfam:zf-CXXC 11 57 1.7e-16 PFAM
PHD 67 129 4e-4 SMART
low complexity region 166 183 N/A INTRINSIC
low complexity region 302 325 N/A INTRINSIC
low complexity region 355 377 N/A INTRINSIC
FBOX 404 444 4.6e-4 SMART
low complexity region 509 520 N/A INTRINSIC
LRR 576 601 3.58e1 SMART
LRR 631 656 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047075
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308

RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047157
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308

RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000061587
AA Change: A100V

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050279
Gene: ENSMUSG00000043964
AA Change: A100V

Pfam:Orai-1 46 271 1.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118865
AA Change: A100V

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112382
Gene: ENSMUSG00000043964
AA Change: A100V

Pfam:Orai-1 42 165 1.5e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121504
SMART Domains Protein: ENSMUSP00000113142
Gene: ENSMUSG00000043964

Pfam:Orai-1 42 94 1.3e-16 PFAM
low complexity region 125 133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

RRM 95 168 7.6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143951
Predicted Effect probably benign
Transcript: ENSMUST00000144406
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308

RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186116
SMART Domains Protein: ENSMUSP00000140083
Gene: ENSMUSG00000030811

low complexity region 10 33 N/A INTRINSIC
low complexity region 63 85 N/A INTRINSIC
FBOX 112 152 3e-6 SMART
low complexity region 217 228 N/A INTRINSIC
LRR 284 309 1.5e-1 SMART
LRR 339 364 5.3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186207
SMART Domains Protein: ENSMUSP00000140303
Gene: ENSMUSG00000030811

Pfam:zf-CXXC 11 57 1.7e-16 PFAM
PHD 67 129 4e-4 SMART
low complexity region 166 183 N/A INTRINSIC
low complexity region 302 325 N/A INTRINSIC
low complexity region 355 377 N/A INTRINSIC
FBOX 404 444 4.6e-4 SMART
low complexity region 509 520 N/A INTRINSIC
LRR 576 601 3.58e1 SMART
LRR 631 656 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188580
SMART Domains Protein: ENSMUSP00000140021
Gene: ENSMUSG00000030811

Pfam:zf-CXXC 11 57 1.3e-16 PFAM
PHD 67 129 4e-4 SMART
low complexity region 186 209 N/A INTRINSIC
low complexity region 239 261 N/A INTRINSIC
FBOX 288 328 4.6e-4 SMART
low complexity region 393 404 N/A INTRINSIC
LRR 460 485 3.58e1 SMART
LRR 515 540 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206893
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,163,230 D132G possibly damaging Het
Abca5 T C 11: 110,277,611 E1424G possibly damaging Het
Adamts4 C T 1: 171,256,600 Q549* probably null Het
Adcy4 A G 14: 55,770,433 I893T possibly damaging Het
Ago1 A T 4: 126,439,505 *858R probably null Het
Ank2 T A 3: 126,958,889 I393L probably damaging Het
Ankrd44 T C 1: 54,648,300 T987A probably benign Het
Ap2a1 G T 7: 44,902,789 N790K probably benign Het
Aqr A G 2: 114,158,868 probably null Het
Arel1 G T 12: 84,941,911 F21L probably damaging Het
Atp1a3 T C 7: 24,987,470 D743G probably damaging Het
Atp9a A T 2: 168,675,352 F354I probably benign Het
Bag6 A G 17: 35,140,842 H259R unknown Het
BC028528 TGGTT TGGTTCTGTGGTCACGGGTT 3: 95,888,186 probably benign Het
Bckdk T A 7: 127,904,973 S15T unknown Het
C4b G T 17: 34,731,080 Y1405* probably null Het
Camk4 G A 18: 32,939,545 probably null Het
Car11 T A 7: 45,700,318 W16R probably benign Het
Ccdc80 A C 16: 45,096,400 E506D probably damaging Het
Chmp6 C T 11: 119,915,443 Q32* probably null Het
Colq G A 14: 31,545,086 P166S possibly damaging Het
Ctxn3 T C 18: 57,477,285 M58T probably damaging Het
Cxcl3 A T 5: 90,786,657 I93L unknown Het
Dnaaf2 T C 12: 69,197,606 Y227C probably damaging Het
Dnmt3a G A 12: 3,904,204 G792D probably damaging Het
Dsg4 T A 18: 20,451,936 probably null Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Fbxl13 T A 5: 21,523,060 R550* probably null Het
Gm4302 A T 10: 100,341,583 Q243L unknown Het
Gm7168 A T 17: 13,949,013 Y214F probably benign Het
Gtf3c1 C T 7: 125,647,491 D1549N probably damaging Het
Gtf3c5 A T 2: 28,571,141 D320E probably damaging Het
Hivep1 T A 13: 42,157,650 V1122D probably damaging Het
Ibtk T C 9: 85,718,934 probably null Het
Irs1 T A 1: 82,287,264 Q1077L probably damaging Het
Ivd A T 2: 118,876,892 M296L possibly damaging Het
Katnal1 T C 5: 148,891,682 D318G probably null Het
L3mbtl3 C T 10: 26,339,231 V194I unknown Het
Malt1 C A 18: 65,448,211 Q237K probably benign Het
March11 C T 15: 26,311,101 A221V possibly damaging Het
Mgea5 G A 19: 45,767,447 R586* probably null Het
Nfe2l3 A G 6: 51,457,544 I361M possibly damaging Het
Nrg1 G A 8: 31,818,654 R493C probably damaging Het
Olfr1019 A T 2: 85,840,963 V276E probably damaging Het
Olfr1212 A C 2: 88,959,048 Y194S probably benign Het
Olfr453 T C 6: 42,744,805 I256T probably damaging Het
Olfr577 G A 7: 102,973,810 P61S probably damaging Het
Olfr828 A T 9: 18,815,933 Y120* probably null Het
Olfr980 T A 9: 40,006,424 H175L probably damaging Het
Oxsm T A 14: 16,241,066 M328L probably benign Het
Pan2 T C 10: 128,308,440 V186A probably benign Het
Pkd1l1 T A 11: 8,916,265 D980V Het
Ppp1r16b T C 2: 158,761,468 Y438H probably damaging Het
Ppp4c A T 7: 126,787,332 H164Q probably damaging Het
Prl8a2 C A 13: 27,352,770 T125K possibly damaging Het
Rasa2 T C 9: 96,566,122 N494S possibly damaging Het
Rpl18a T C 8: 70,895,506 D147G probably benign Het
Scg3 T C 9: 75,669,277 D272G possibly damaging Het
Serpinb6c T A 13: 33,893,835 D184V probably benign Het
Simc1 T G 13: 54,524,349 L170R possibly damaging Het
Slx4 T C 16: 3,980,131 E1463G possibly damaging Het
Stk31 T A 6: 49,439,232 probably null Het
Tas1r3 A G 4: 155,862,023 I375T probably damaging Het
Tbc1d24 T C 17: 24,182,520 D405G probably damaging Het
Tcerg1l G A 7: 138,259,828 P391S probably damaging Het
Tiam1 T C 16: 89,898,195 S125G probably benign Het
Trim16 C A 11: 62,834,123 H246N probably damaging Het
Tti1 T A 2: 157,995,472 N896I probably damaging Het
Ubash3a A G 17: 31,232,312 N395S probably damaging Het
Uggt1 T C 1: 36,164,508 I1014V probably benign Het
Vmn1r30 T A 6: 58,435,229 Q206L possibly damaging Het
Washc5 T A 15: 59,337,204 N1057I probably benign Het
Xpo4 GGTATTAGCGGAGT GGT 14: 57,602,621 probably null Het
Zcchc14 A T 8: 121,605,017 S536T unknown Het
Other mutations in Orai3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02378:Orai3 APN 7 127770161 missense probably damaging 1.00
IGL03105:Orai3 APN 7 127773553 unclassified probably benign
R1493:Orai3 UTSW 7 127773905 missense possibly damaging 0.69
R4795:Orai3 UTSW 7 127773888 missense probably benign 0.03
R4973:Orai3 UTSW 7 127774176 missense probably damaging 1.00
R6053:Orai3 UTSW 7 127773878 missense probably benign 0.00
R6684:Orai3 UTSW 7 127773720 missense probably damaging 1.00
R7651:Orai3 UTSW 7 127774064 missense probably damaging 0.97
R7762:Orai3 UTSW 7 127773571 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-10-17