Incidental Mutation 'R7490:Bckdk'
ID580679
Institutional Source Beutler Lab
Gene Symbol Bckdk
Ensembl Gene ENSMUSG00000030802
Gene Namebranched chain ketoacid dehydrogenase kinase
SynonymsBCKD-kinase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R7490 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location127904082-127910221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127904973 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 15 (S15T)
Ref Sequence ENSEMBL: ENSMUSP00000070345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071056] [ENSMUST00000124533] [ENSMUST00000151451] [ENSMUST00000206140] [ENSMUST00000206745]
Predicted Effect unknown
Transcript: ENSMUST00000071056
AA Change: S15T
SMART Domains Protein: ENSMUSP00000070345
Gene: ENSMUSG00000030802
AA Change: S15T

DomainStartEndE-ValueType
low complexity region 7 35 N/A INTRINSIC
Pfam:BCDHK_Adom3 69 222 1.8e-44 PFAM
HATPase_c 264 404 2.06e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000124533
AA Change: S15T
Predicted Effect unknown
Transcript: ENSMUST00000151451
AA Change: S15T
SMART Domains Protein: ENSMUSP00000116990
Gene: ENSMUSG00000030802
AA Change: S15T

DomainStartEndE-ValueType
low complexity region 7 35 N/A INTRINSIC
Pfam:BCDHK_Adom3 68 214 1.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206068
Predicted Effect unknown
Transcript: ENSMUST00000206140
AA Change: S15T
Predicted Effect unknown
Transcript: ENSMUST00000206745
AA Change: S15T
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-ketoacid dehydrogenase complex (BCKD) is an important regulator of the valine, leucine, and isoleucine catabolic pathways. The protein encoded by this gene is found in the mitochondrion, where it phosphorylates and inactivates BCKD. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Nullizygous mutations lead to altered amino acid metabolism, gait anomalies and neurobehavioral phenotypes. Homozygotes for a gene trapped allele show impaired growth, reduced fertility and epileptic seizures. Homozygotes for another gene trapped allele show motor delay and autism-like behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,163,230 D132G possibly damaging Het
Abca5 T C 11: 110,277,611 E1424G possibly damaging Het
Adamts4 C T 1: 171,256,600 Q549* probably null Het
Adcy4 A G 14: 55,770,433 I893T possibly damaging Het
Ago1 A T 4: 126,439,505 *858R probably null Het
Ank2 T A 3: 126,958,889 I393L probably damaging Het
Ankrd44 T C 1: 54,648,300 T987A probably benign Het
Ap2a1 G T 7: 44,902,789 N790K probably benign Het
Aqr A G 2: 114,158,868 probably null Het
Arel1 G T 12: 84,941,911 F21L probably damaging Het
Atp1a3 T C 7: 24,987,470 D743G probably damaging Het
Atp9a A T 2: 168,675,352 F354I probably benign Het
Bag6 A G 17: 35,140,842 H259R unknown Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCTGTG GTCACTGGTTCTGTGTTCACTGGTTCTGTG 3: 95,888,166 probably benign Het
BC028528 TGGTT TGGTTCTGTGGTCACGGGTT 3: 95,888,186 probably benign Het
C4b G T 17: 34,731,080 Y1405* probably null Het
Camk4 G A 18: 32,939,545 probably null Het
Car11 T A 7: 45,700,318 W16R probably benign Het
Ccdc80 A C 16: 45,096,400 E506D probably damaging Het
Chmp6 C T 11: 119,915,443 Q32* probably null Het
Colq G A 14: 31,545,086 P166S possibly damaging Het
Ctxn3 T C 18: 57,477,285 M58T probably damaging Het
Cxcl3 A T 5: 90,786,657 I93L unknown Het
Dnaaf2 T C 12: 69,197,606 Y227C probably damaging Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dnmt3a G A 12: 3,904,204 G792D probably damaging Het
Dsg4 T A 18: 20,451,936 probably null Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Fbxl13 T A 5: 21,523,060 R550* probably null Het
Gm4302 A T 10: 100,341,583 Q243L unknown Het
Gm7168 A T 17: 13,949,013 Y214F probably benign Het
Gtf3c1 C T 7: 125,647,491 D1549N probably damaging Het
Gtf3c5 A T 2: 28,571,141 D320E probably damaging Het
Hivep1 T A 13: 42,157,650 V1122D probably damaging Het
Ibtk T C 9: 85,718,934 probably null Het
Irs1 T A 1: 82,287,264 Q1077L probably damaging Het
Ivd A T 2: 118,876,892 M296L possibly damaging Het
Katnal1 T C 5: 148,891,682 D318G probably null Het
L3mbtl3 C T 10: 26,339,231 V194I unknown Het
Malt1 C A 18: 65,448,211 Q237K probably benign Het
March11 C T 15: 26,311,101 A221V possibly damaging Het
Mgea5 G A 19: 45,767,447 R586* probably null Het
Nfe2l3 A G 6: 51,457,544 I361M possibly damaging Het
Nrg1 G A 8: 31,818,654 R493C probably damaging Het
Olfr1019 A T 2: 85,840,963 V276E probably damaging Het
Olfr1212 A C 2: 88,959,048 Y194S probably benign Het
Olfr453 T C 6: 42,744,805 I256T probably damaging Het
Olfr577 G A 7: 102,973,810 P61S probably damaging Het
Olfr828 A T 9: 18,815,933 Y120* probably null Het
Olfr980 T A 9: 40,006,424 H175L probably damaging Het
Orai3 C T 7: 127,773,627 A100V possibly damaging Het
Oxsm T A 14: 16,241,066 M328L probably benign Het
Pan2 T C 10: 128,308,440 V186A probably benign Het
Pkd1l1 T A 11: 8,916,265 D980V Het
Ppp1r16b T C 2: 158,761,468 Y438H probably damaging Het
Ppp4c A T 7: 126,787,332 H164Q probably damaging Het
Prl8a2 C A 13: 27,352,770 T125K possibly damaging Het
Rasa2 T C 9: 96,566,122 N494S possibly damaging Het
Rpl18a T C 8: 70,895,506 D147G probably benign Het
Scg3 T C 9: 75,669,277 D272G possibly damaging Het
Serpinb6c T A 13: 33,893,835 D184V probably benign Het
Simc1 T G 13: 54,524,349 L170R possibly damaging Het
Slx4 T C 16: 3,980,131 E1463G possibly damaging Het
Stk31 T A 6: 49,439,232 probably null Het
Tas1r3 A G 4: 155,862,023 I375T probably damaging Het
Tbc1d24 T C 17: 24,182,520 D405G probably damaging Het
Tcerg1l G A 7: 138,259,828 P391S probably damaging Het
Tiam1 T C 16: 89,898,195 S125G probably benign Het
Trim16 C A 11: 62,834,123 H246N probably damaging Het
Tti1 T A 2: 157,995,472 N896I probably damaging Het
Ubash3a A G 17: 31,232,312 N395S probably damaging Het
Uggt1 T C 1: 36,164,508 I1014V probably benign Het
Vmn1r30 T A 6: 58,435,229 Q206L possibly damaging Het
Washc5 T A 15: 59,337,204 N1057I probably benign Het
Xpo4 GGTATTAGCGGAGT GGT 14: 57,602,621 probably null Het
Zcchc14 A T 8: 121,605,017 S536T unknown Het
Other mutations in Bckdk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Bckdk APN 7 127905776 missense possibly damaging 0.67
IGL02176:Bckdk APN 7 127906373 missense probably benign 0.31
IGL02444:Bckdk APN 7 127907446 missense probably damaging 1.00
dottie UTSW 7 127906400 nonsense probably null
Squished UTSW 7 127905418 missense probably damaging 1.00
R2105:Bckdk UTSW 7 127907317 missense probably damaging 1.00
R2240:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R2252:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R2474:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3696:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3697:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3747:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3749:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3750:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3981:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R4091:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R4303:Bckdk UTSW 7 127905330 intron probably benign
R4367:Bckdk UTSW 7 127906419 missense probably benign 0.07
R4369:Bckdk UTSW 7 127906419 missense probably benign 0.07
R4371:Bckdk UTSW 7 127906419 missense probably benign 0.07
R4841:Bckdk UTSW 7 127905461 unclassified probably null
R5615:Bckdk UTSW 7 127907317 missense probably damaging 1.00
R5930:Bckdk UTSW 7 127905973 missense probably damaging 1.00
R7215:Bckdk UTSW 7 127905110 missense possibly damaging 0.82
R7596:Bckdk UTSW 7 127906400 nonsense probably null
R7772:Bckdk UTSW 7 127905901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAGATGGAAGCTGCTGTGCG -3'
(R):5'- TAGCTCAGCCCTTCCCCATAAG -3'

Sequencing Primer
(F):5'- AGCACGTCTGCATCCTCGAG -3'
(R):5'- CCCATAAGACTTATTCTGTGAGTCAC -3'
Posted On2019-10-17