Incidental Mutation 'R7490:Zcchc14'
ID580683
Institutional Source Beutler Lab
Gene Symbol Zcchc14
Ensembl Gene ENSMUSG00000061410
Gene Namezinc finger, CCHC domain containing 14
SynonymsBdg29
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7490 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location121598703-121652901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121605017 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 536 (S536T)
Ref Sequence ENSEMBL: ENSMUSP00000040360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046386] [ENSMUST00000127664]
Predicted Effect unknown
Transcript: ENSMUST00000046386
AA Change: S536T
SMART Domains Protein: ENSMUSP00000040360
Gene: ENSMUSG00000061410
AA Change: S536T

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
low complexity region 129 145 N/A INTRINSIC
low complexity region 206 225 N/A INTRINSIC
low complexity region 246 265 N/A INTRINSIC
Blast:SAM 299 349 2e-25 BLAST
SCOP:d1kw4a_ 307 358 1e-6 SMART
low complexity region 422 432 N/A INTRINSIC
low complexity region 438 454 N/A INTRINSIC
low complexity region 532 543 N/A INTRINSIC
low complexity region 709 790 N/A INTRINSIC
low complexity region 791 808 N/A INTRINSIC
ZnF_C2HC 914 930 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154725
SMART Domains Protein: ENSMUSP00000120570
Gene: ENSMUSG00000061410

DomainStartEndE-ValueType
low complexity region 7 88 N/A INTRINSIC
low complexity region 89 106 N/A INTRINSIC
ZnF_C2HC 212 228 3.44e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,163,230 D132G possibly damaging Het
Abca5 T C 11: 110,277,611 E1424G possibly damaging Het
Adamts4 C T 1: 171,256,600 Q549* probably null Het
Adcy4 A G 14: 55,770,433 I893T possibly damaging Het
Ago1 A T 4: 126,439,505 *858R probably null Het
Ank2 T A 3: 126,958,889 I393L probably damaging Het
Ankrd44 T C 1: 54,648,300 T987A probably benign Het
Ap2a1 G T 7: 44,902,789 N790K probably benign Het
Aqr A G 2: 114,158,868 probably null Het
Arel1 G T 12: 84,941,911 F21L probably damaging Het
Atp1a3 T C 7: 24,987,470 D743G probably damaging Het
Atp9a A T 2: 168,675,352 F354I probably benign Het
Bag6 A G 17: 35,140,842 H259R unknown Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCTGTG GTCACTGGTTCTGTGTTCACTGGTTCTGTG 3: 95,888,166 probably benign Het
BC028528 TGGTT TGGTTCTGTGGTCACGGGTT 3: 95,888,186 probably benign Het
Bckdk T A 7: 127,904,973 S15T unknown Het
C4b G T 17: 34,731,080 Y1405* probably null Het
Camk4 G A 18: 32,939,545 probably null Het
Car11 T A 7: 45,700,318 W16R probably benign Het
Ccdc80 A C 16: 45,096,400 E506D probably damaging Het
Chmp6 C T 11: 119,915,443 Q32* probably null Het
Colq G A 14: 31,545,086 P166S possibly damaging Het
Ctxn3 T C 18: 57,477,285 M58T probably damaging Het
Cxcl3 A T 5: 90,786,657 I93L unknown Het
Dnaaf2 T C 12: 69,197,606 Y227C probably damaging Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dnmt3a G A 12: 3,904,204 G792D probably damaging Het
Dsg4 T A 18: 20,451,936 probably null Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Fbxl13 T A 5: 21,523,060 R550* probably null Het
Gm4302 A T 10: 100,341,583 Q243L unknown Het
Gm7168 A T 17: 13,949,013 Y214F probably benign Het
Gtf3c1 C T 7: 125,647,491 D1549N probably damaging Het
Gtf3c5 A T 2: 28,571,141 D320E probably damaging Het
Hivep1 T A 13: 42,157,650 V1122D probably damaging Het
Ibtk T C 9: 85,718,934 probably null Het
Irs1 T A 1: 82,287,264 Q1077L probably damaging Het
Ivd A T 2: 118,876,892 M296L possibly damaging Het
Katnal1 T C 5: 148,891,682 D318G probably null Het
L3mbtl3 C T 10: 26,339,231 V194I unknown Het
Malt1 C A 18: 65,448,211 Q237K probably benign Het
March11 C T 15: 26,311,101 A221V possibly damaging Het
Mgea5 G A 19: 45,767,447 R586* probably null Het
Nfe2l3 A G 6: 51,457,544 I361M possibly damaging Het
Nrg1 G A 8: 31,818,654 R493C probably damaging Het
Olfr1019 A T 2: 85,840,963 V276E probably damaging Het
Olfr1212 A C 2: 88,959,048 Y194S probably benign Het
Olfr453 T C 6: 42,744,805 I256T probably damaging Het
Olfr577 G A 7: 102,973,810 P61S probably damaging Het
Olfr828 A T 9: 18,815,933 Y120* probably null Het
Olfr980 T A 9: 40,006,424 H175L probably damaging Het
Orai3 C T 7: 127,773,627 A100V possibly damaging Het
Oxsm T A 14: 16,241,066 M328L probably benign Het
Pan2 T C 10: 128,308,440 V186A probably benign Het
Pkd1l1 T A 11: 8,916,265 D980V Het
Ppp1r16b T C 2: 158,761,468 Y438H probably damaging Het
Ppp4c A T 7: 126,787,332 H164Q probably damaging Het
Prl8a2 C A 13: 27,352,770 T125K possibly damaging Het
Rasa2 T C 9: 96,566,122 N494S possibly damaging Het
Rpl18a T C 8: 70,895,506 D147G probably benign Het
Scg3 T C 9: 75,669,277 D272G possibly damaging Het
Serpinb6c T A 13: 33,893,835 D184V probably benign Het
Simc1 T G 13: 54,524,349 L170R possibly damaging Het
Slx4 T C 16: 3,980,131 E1463G possibly damaging Het
Stk31 T A 6: 49,439,232 probably null Het
Tas1r3 A G 4: 155,862,023 I375T probably damaging Het
Tbc1d24 T C 17: 24,182,520 D405G probably damaging Het
Tcerg1l G A 7: 138,259,828 P391S probably damaging Het
Tiam1 T C 16: 89,898,195 S125G probably benign Het
Trim16 C A 11: 62,834,123 H246N probably damaging Het
Tti1 T A 2: 157,995,472 N896I probably damaging Het
Ubash3a A G 17: 31,232,312 N395S probably damaging Het
Uggt1 T C 1: 36,164,508 I1014V probably benign Het
Vmn1r30 T A 6: 58,435,229 Q206L possibly damaging Het
Washc5 T A 15: 59,337,204 N1057I probably benign Het
Xpo4 GGTATTAGCGGAGT GGT 14: 57,602,621 probably null Het
Other mutations in Zcchc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02035:Zcchc14 APN 8 121604615 unclassified probably benign
IGL02060:Zcchc14 APN 8 121603895 missense probably damaging 0.98
IGL02455:Zcchc14 APN 8 121606270 unclassified probably benign
IGL03196:Zcchc14 APN 8 121609138 unclassified probably benign
P0033:Zcchc14 UTSW 8 121610159 intron probably benign
R0483:Zcchc14 UTSW 8 121628649 intron probably benign
R0639:Zcchc14 UTSW 8 121605449 nonsense probably null
R1013:Zcchc14 UTSW 8 121606925 unclassified probably benign
R1129:Zcchc14 UTSW 8 121608415 unclassified probably benign
R1546:Zcchc14 UTSW 8 121604263 intron probably benign
R1563:Zcchc14 UTSW 8 121603979 missense probably benign 0.10
R1861:Zcchc14 UTSW 8 121609251 unclassified probably benign
R2200:Zcchc14 UTSW 8 121605428 unclassified probably benign
R2419:Zcchc14 UTSW 8 121603936 missense probably damaging 0.99
R4246:Zcchc14 UTSW 8 121604292 small deletion probably benign
R4249:Zcchc14 UTSW 8 121604292 small deletion probably benign
R4424:Zcchc14 UTSW 8 121651941 intron probably benign
R4470:Zcchc14 UTSW 8 121651759 intron probably benign
R4520:Zcchc14 UTSW 8 121609095 unclassified probably benign
R4681:Zcchc14 UTSW 8 121608600 unclassified probably benign
R5253:Zcchc14 UTSW 8 121618694 intron probably benign
R5314:Zcchc14 UTSW 8 121608598 unclassified probably benign
R5591:Zcchc14 UTSW 8 121605448 unclassified probably benign
R5746:Zcchc14 UTSW 8 121604639 unclassified probably benign
R5781:Zcchc14 UTSW 8 121604593 unclassified probably benign
R5897:Zcchc14 UTSW 8 121605160 unclassified probably benign
R5930:Zcchc14 UTSW 8 121611358 intron probably benign
R5963:Zcchc14 UTSW 8 121628623 intron probably benign
R6364:Zcchc14 UTSW 8 121604859 unclassified probably benign
R6562:Zcchc14 UTSW 8 121604103 missense probably damaging 0.99
R6579:Zcchc14 UTSW 8 121604467 intron probably benign
R6592:Zcchc14 UTSW 8 121604639 unclassified probably benign
R6699:Zcchc14 UTSW 8 121608616 unclassified probably benign
R7195:Zcchc14 UTSW 8 121608461 missense unknown
R7420:Zcchc14 UTSW 8 121651791 intron probably benign
R7597:Zcchc14 UTSW 8 121608500 missense unknown
R7758:Zcchc14 UTSW 8 121604689 missense unknown
R7773:Zcchc14 UTSW 8 121651775 missense unknown
R7831:Zcchc14 UTSW 8 121605245 missense not run
R7889:Zcchc14 UTSW 8 121604895 missense unknown
R7914:Zcchc14 UTSW 8 121605245 missense not run
R7972:Zcchc14 UTSW 8 121604895 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCTGCATGCACAACTTTG -3'
(R):5'- GATGCTGCTGGCTCACTTTC -3'

Sequencing Primer
(F):5'- ATGCACAACTTTGGCCCG -3'
(R):5'- TTCCGTCCAGCTCTGCGAG -3'
Posted On2019-10-17